ID: 910182554

View in Genome Browser
Species Human (GRCh38)
Location 1:84501775-84501797
Sequence ACTAGTTATTCCTACAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910182552_910182554 28 Left 910182552 1:84501724-84501746 CCAAAGGAAAGGGCATGGGATGA 0: 1
1: 0
2: 2
3: 18
4: 227
Right 910182554 1:84501775-84501797 ACTAGTTATTCCTACAGTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910182554 Original CRISPR ACTAGTTATTCCTACAGTGT GGG Intronic
902473467 1:16666693-16666715 AGTTGTTAATCCTACAGTGGAGG - Intergenic
902485336 1:16740749-16740771 AGTTGTTAATCCTACAGTGGAGG + Intronic
907881307 1:58551430-58551452 ACTATTTTTTCTTACAGTTTGGG - Intergenic
910182554 1:84501775-84501797 ACTAGTTATTCCTACAGTGTGGG + Intronic
917694144 1:177502787-177502809 AGTATTTTTTCCTAGAGTGTAGG - Intergenic
1063102393 10:2962110-2962132 CCTAATTCTCCCTACAGTGTTGG + Intergenic
1067576573 10:47412460-47412482 ACTAGTTTTTTCTCCAATGTGGG + Intergenic
1068108880 10:52654773-52654795 TCTAGTTCTTCACACAGTGTAGG + Intergenic
1071747527 10:88438717-88438739 AATATTTATTTCAACAGTGTGGG + Intronic
1072008560 10:91282906-91282928 AATATATATTCCTACAGTTTGGG + Exonic
1077623432 11:3748752-3748774 GCTATTTTTTCCTACAGGGTTGG + Intronic
1082913428 11:58403512-58403534 ACAAGTTATTGCTACAATGAAGG - Intergenic
1088755893 11:112884885-112884907 ACTAGGTATTCCCAGAGTGCTGG + Intergenic
1090223505 11:125052893-125052915 ACTACTGATTCCTATTGTGTTGG - Intergenic
1092027083 12:5250219-5250241 ACCAGTAATTAGTACAGTGTTGG - Intergenic
1094070520 12:26407793-26407815 ACTAGTTATCCTTACATTTTCGG - Intronic
1094664932 12:32510430-32510452 ACTAGTTATTTCTAGATTTTAGG + Intronic
1096795881 12:54077324-54077346 ACTAGGAATTCCTGCAGTGCAGG - Intergenic
1097119856 12:56722997-56723019 ACTAGTTTTTCCTGGAGAGTGGG + Intronic
1100558342 12:95720938-95720960 AATAGTTATACCTACTGTATGGG - Intronic
1101175681 12:102149064-102149086 TCTAGTTATTTTTAAAGTGTTGG + Intronic
1108155356 13:47578722-47578744 ACTAGAAATTACTACAGTTTAGG + Intergenic
1112142440 13:96660097-96660119 TCTTGTTATTCCTACAGCTTTGG - Intronic
1114305524 14:21419770-21419792 ACTAGAAATTCCTGGAGTGTCGG + Intronic
1116734137 14:48667509-48667531 ACTAGTTCTTCCTATTGTGGTGG - Intergenic
1116882717 14:50187652-50187674 ACTAATTATTTTTAAAGTGTGGG + Intronic
1118884836 14:69857922-69857944 ACTAGTTATACATACAGTAGGGG + Intronic
1119537812 14:75417212-75417234 GGTAGTGATTCCTACCGTGTAGG - Intergenic
1120839580 14:89072979-89073001 ATTAGTTATTGCTACAGTAAGGG - Intergenic
1123794759 15:23760630-23760652 ACTATTTATTCCTGAAGTGCTGG + Intergenic
1127508569 15:59618385-59618407 ACAAGATATTCCTACAGTACTGG - Exonic
1128825646 15:70713460-70713482 ACTAGTTGTTCCCACTGTCTGGG - Intronic
1130421722 15:83754575-83754597 ACTAGTTATTTCTAGAAAGTAGG - Intronic
1130548988 15:84877466-84877488 ATTAATTATTCCTCCTGTGTCGG - Intergenic
1131528832 15:93174737-93174759 ACTAGTAATTTCTACTATGTAGG - Intergenic
1132135168 15:99329483-99329505 ACAATTTATACCTCCAGTGTTGG - Intronic
1138471440 16:57241203-57241225 AATAGGTAATGCTACAGTGTTGG + Intergenic
1140873509 16:79128685-79128707 CCTACTTATTTCTAAAGTGTTGG + Intronic
1143775902 17:9198589-9198611 ACCAGGTTTTTCTACAGTGTAGG - Intronic
1144359709 17:14480315-14480337 GCCTGTTATTCCTACAGTTTGGG - Intergenic
1146012658 17:29208126-29208148 ACTAGATAATACTACAGTGTAGG + Intergenic
1147481493 17:40768815-40768837 ACTAGGTTTTCCCACAGTATAGG - Intronic
1156013141 18:32516822-32516844 ACTAGCTGTTCCTACTGCGTGGG + Intergenic
1159662143 18:71111016-71111038 ACAAGCTAGTCCTTCAGTGTTGG + Intergenic
1159965866 18:74595872-74595894 AATAGCTATTTCAACAGTGTTGG - Intergenic
1168579927 19:57546883-57546905 AGGACTTCTTCCTACAGTGTGGG + Exonic
927176007 2:20408325-20408347 ATTAGCTATTGCTACAGTATTGG + Intergenic
929179789 2:39025258-39025280 AGTAGGTATTCCTAAATTGTTGG - Intronic
929613896 2:43293067-43293089 ACTAGCCATTGCTGCAGTGTGGG - Exonic
931462870 2:62463403-62463425 AGTAGTTATTACTATAATGTTGG - Intergenic
931842082 2:66163326-66163348 ACTATTTATTCCTTCAATGTTGG - Intergenic
932964553 2:76456221-76456243 ATGAGGTATTCCTACAGTTTAGG + Intergenic
939841669 2:147196778-147196800 AATAGTAATTCCTACTTTGTAGG - Intergenic
940256245 2:151733368-151733390 TCTCTTTATTCCTTCAGTGTTGG + Intronic
941669375 2:168275267-168275289 AGGAGTTAATGCTACAGTGTTGG - Intergenic
944345702 2:198662880-198662902 ACAATTTCTTCCTACAGTGAAGG + Intergenic
947117268 2:226785200-226785222 ACTAGTTATTCACTCAGTCTTGG + Intronic
1168914750 20:1476600-1476622 TCAAGGTAATCCTACAGTGTAGG + Intronic
1176987923 21:15459394-15459416 TCTTGTTATTACTACAGTTTGGG + Intergenic
1185201504 22:49508601-49508623 ACAAGTTATACCTCCAGTATTGG + Intronic
950743700 3:15069846-15069868 CCCAGTTATTCCTGCAGTGCTGG - Intergenic
953550664 3:43900093-43900115 ACTAGGTATTCCTACTGGGTGGG + Intergenic
953550875 3:43901543-43901565 ACTAGGTATTCCTACTGGGTGGG - Intergenic
956682803 3:71797175-71797197 AATAATAATACCTACAGTGTAGG + Intergenic
958599207 3:96272670-96272692 AATAATTATTTTTACAGTGTGGG - Intergenic
960385086 3:117012873-117012895 ACCAGTTATACCTACACTGAGGG - Intronic
962301137 3:134244168-134244190 ACTGGTTATGCCAACAGTGGTGG - Intronic
965665442 3:171088754-171088776 ACTAGTCAGGCCTACAATGTGGG - Intronic
966626898 3:182026715-182026737 GCTAATTATTCCTGCTGTGTAGG + Intergenic
967421453 3:189277781-189277803 AATAGTGATTCCAACAATGTGGG - Intronic
968207230 3:196814169-196814191 ACTAGTAATTTCTATATTGTAGG + Intronic
968802722 4:2754020-2754042 ACTAGTCATCCCTGCACTGTGGG + Intronic
972819096 4:42679022-42679044 ACTAGTTGTTCCTCCAATTTAGG - Intergenic
973060352 4:45716490-45716512 ACTGGTTATTTCTCCAGTCTGGG + Intergenic
974456517 4:62135256-62135278 ACTATTATTTCCTACAGTGTAGG + Intergenic
976749121 4:88436340-88436362 AAAAGTTTTTCTTACAGTGTTGG + Intronic
977823465 4:101502822-101502844 CCTGGTTTTTCCTACAGCGTGGG + Intronic
982540953 4:156670125-156670147 ACTAGTTATTTCTACTTTTTTGG + Intergenic
989553851 5:42768352-42768374 ACTATTGATTCCTACTGTTTAGG - Intronic
995070105 5:107910745-107910767 ACTGGTTCTTGCTACTGTGTTGG - Intronic
998031678 5:138875522-138875544 ACATGATATTCCTTCAGTGTAGG + Intronic
1000724324 5:164750618-164750640 TCTTATTATTCCCACAGTGTTGG + Intergenic
1006894281 6:37456959-37456981 ACTTGTAATTCCAACACTGTGGG + Intronic
1008944313 6:57080714-57080736 ACTTGTAATTCCTACATTTTGGG + Intergenic
1010234314 6:73562447-73562469 ACTAGGTATTCATGCACTGTTGG - Intergenic
1013428510 6:110035742-110035764 ACCTGTTATTCCAACACTGTGGG + Intergenic
1013737419 6:113243927-113243949 ACTTTGTATTCCTACAGTATTGG + Intergenic
1014684490 6:124478790-124478812 ACTATTCATTCCTTTAGTGTGGG + Intronic
1015330420 6:131972183-131972205 ACAAGCTATTACTACAGTGAGGG - Intergenic
1016721268 6:147301763-147301785 ACTAGTTTATTATACAGTGTAGG - Intronic
1018160748 6:161040101-161040123 ACGAGGTATTCATACATTGTTGG - Intronic
1019201030 6:170315383-170315405 ATTTGTTATTCCAACAGAGTAGG - Intronic
1019900076 7:4013688-4013710 ACAAGTTTTTCCTCCAGCGTCGG + Intronic
1021802835 7:24324982-24325004 ACTAGCTTTTCTTACAGTGGTGG + Intergenic
1029047703 7:97647239-97647261 ACTAGTTTCCCCTACAATGTTGG + Intergenic
1033729709 7:144165036-144165058 ACAATTTATTCCTCCAGTATTGG - Intergenic
1033941873 7:146664715-146664737 AATATTTCTTCCTTCAGTGTTGG + Intronic
1037305766 8:17501979-17502001 ACTAGTTTTTCCCACAGTTGTGG + Intronic
1037867665 8:22459570-22459592 ACATGTTATGCCTACATTGTTGG + Intronic
1040738658 8:50543804-50543826 AACAGTCATTCCTACATTGTTGG - Intronic
1040840852 8:51782519-51782541 CCTAATTATTGCTACAGTGCAGG + Intronic
1041440723 8:57893571-57893593 ACTCTCTATTCCTACAATGTGGG - Intergenic
1043183193 8:77110724-77110746 AATAGTTATTTCTACATAGTGGG - Intergenic
1044022961 8:87129243-87129265 ACTACTTCTTCCTAAAATGTTGG + Intronic
1044372773 8:91432879-91432901 ACTTGTAACTCCTACAGTATAGG + Intergenic
1045673742 8:104586919-104586941 ACTCCTTTTTCCAACAGTGTGGG - Intronic
1047038054 8:120961382-120961404 ACTAGTTCTTGTTACAGTGTAGG + Intergenic
1047777654 8:128086766-128086788 ACTCCTTGTTCCTACAGGGTGGG + Intergenic
1053188598 9:36039853-36039875 CCTAGCTCTTTCTACAGTGTGGG - Intronic
1053785503 9:41649995-41650017 ACTAGGAATTCCTGCAGTGTAGG - Intergenic
1054159528 9:61664178-61664200 ACTAGGAATTCCTGCAGTGCAGG + Intergenic
1054174222 9:61863947-61863969 ACTAGGAATTCCTGCAGTGCAGG - Intergenic
1054449081 9:65393014-65393036 ACTAGGAATTCCTGCAGTGCAGG - Intergenic
1054663315 9:67716834-67716856 ACTAGGAATTCCTGCAGTGCAGG + Intergenic
1056034031 9:82584914-82584936 ACTAATGATTCCTACATTGTGGG - Intergenic
1056053852 9:82800080-82800102 ATTATTTATTCCTACATTTTAGG + Intergenic
1059003566 9:110376563-110376585 ACCAGTTTTTCCTACAGGGCAGG - Intronic
1188348051 X:29092857-29092879 ACTAGTTATTGTGATAGTGTTGG + Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1193879809 X:86908194-86908216 ACTAGGTATTGCTCCAGTGGGGG + Intergenic
1196309277 X:114143015-114143037 TCTATTTATTCCTACAGGGTAGG + Intergenic
1198123136 X:133614648-133614670 TTTATTTCTTCCTACAGTGTGGG - Intronic