ID: 910184328

View in Genome Browser
Species Human (GRCh38)
Location 1:84520398-84520420
Sequence TAAGTTGGCCACTTGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910184328_910184332 20 Left 910184328 1:84520398-84520420 CCAAGTGCCAAGTGGCCAACTTA No data
Right 910184332 1:84520441-84520463 TTTGGTTTTTGTTTGTTCAGAGG No data
910184328_910184331 2 Left 910184328 1:84520398-84520420 CCAAGTGCCAAGTGGCCAACTTA No data
Right 910184331 1:84520423-84520445 AACAAATTTTTAGTTCATTTTGG No data
910184328_910184333 21 Left 910184328 1:84520398-84520420 CCAAGTGCCAAGTGGCCAACTTA No data
Right 910184333 1:84520442-84520464 TTGGTTTTTGTTTGTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910184328 Original CRISPR TAAGTTGGCCACTTGGCACT TGG (reversed) Intergenic
No off target data available for this crispr