ID: 910189482

View in Genome Browser
Species Human (GRCh38)
Location 1:84581052-84581074
Sequence TGCTGGGGATAAAACTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910189482_910189487 4 Left 910189482 1:84581052-84581074 CCGGTGCAGTTTTATCCCCAGCA No data
Right 910189487 1:84581079-84581101 TCCCTCTACCTGCCACTAAGAGG No data
910189482_910189489 5 Left 910189482 1:84581052-84581074 CCGGTGCAGTTTTATCCCCAGCA No data
Right 910189489 1:84581080-84581102 CCCTCTACCTGCCACTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910189482 Original CRISPR TGCTGGGGATAAAACTGCAC CGG (reversed) Intergenic
No off target data available for this crispr