ID: 910191244

View in Genome Browser
Species Human (GRCh38)
Location 1:84598136-84598158
Sequence CATCCTACCCCGCAGCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910191239_910191244 -7 Left 910191239 1:84598120-84598142 CCCTCTGTCATCTGGCCATCCTA No data
Right 910191244 1:84598136-84598158 CATCCTACCCCGCAGCTGAGGGG No data
910191237_910191244 20 Left 910191237 1:84598093-84598115 CCAACTGCAAACAAGAGAGAGAA No data
Right 910191244 1:84598136-84598158 CATCCTACCCCGCAGCTGAGGGG No data
910191236_910191244 29 Left 910191236 1:84598084-84598106 CCAAAACTGCCAACTGCAAACAA No data
Right 910191244 1:84598136-84598158 CATCCTACCCCGCAGCTGAGGGG No data
910191240_910191244 -8 Left 910191240 1:84598121-84598143 CCTCTGTCATCTGGCCATCCTAC No data
Right 910191244 1:84598136-84598158 CATCCTACCCCGCAGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910191244 Original CRISPR CATCCTACCCCGCAGCTGAG GGG Intergenic
No off target data available for this crispr