ID: 910192016

View in Genome Browser
Species Human (GRCh38)
Location 1:84604459-84604481
Sequence GGATCACGAAATCCCCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910192016_910192018 20 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192018 1:84604502-84604524 CTCCTAATGATAGCACTTCCTGG 0: 2
1: 1
2: 3
3: 9
4: 99
910192016_910192023 27 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192023 1:84604509-84604531 TGATAGCACTTCCTGGGGTTGGG 0: 2
1: 0
2: 3
3: 12
4: 137
910192016_910192021 22 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192021 1:84604504-84604526 CCTAATGATAGCACTTCCTGGGG 0: 2
1: 1
2: 3
3: 13
4: 106
910192016_910192022 26 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192022 1:84604508-84604530 ATGATAGCACTTCCTGGGGTTGG 0: 2
1: 1
2: 3
3: 11
4: 151
910192016_910192019 21 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192019 1:84604503-84604525 TCCTAATGATAGCACTTCCTGGG 0: 2
1: 1
2: 3
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910192016 Original CRISPR GGATCACGAAATCCCCCTGT CGG (reversed) Intergenic
No off target data available for this crispr