ID: 910192018

View in Genome Browser
Species Human (GRCh38)
Location 1:84604502-84604524
Sequence CTCCTAATGATAGCACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 1, 2: 3, 3: 9, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910192016_910192018 20 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192018 1:84604502-84604524 CTCCTAATGATAGCACTTCCTGG 0: 2
1: 1
2: 3
3: 9
4: 99
910192017_910192018 -1 Left 910192017 1:84604480-84604502 CCAGATCTGAAAGACTATTTAAC No data
Right 910192018 1:84604502-84604524 CTCCTAATGATAGCACTTCCTGG 0: 2
1: 1
2: 3
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910192018 Original CRISPR CTCCTAATGATAGCACTTCC TGG Intergenic
900542628 1:3211693-3211715 CCCCTAATGTTGGCACTTCACGG + Intronic
902526672 1:17063292-17063314 TTCCTACTGATGGCAATTCCTGG - Intergenic
907869450 1:58430099-58430121 CTCCTAATACTATCACTTCAGGG + Intronic
910192018 1:84604502-84604524 CTCCTAATGATAGCACTTCCTGG + Intergenic
913580202 1:120219114-120219136 CTCCTAATGCTATCCCTCCCCGG + Intergenic
915403845 1:155644172-155644194 CTCCCAATGATAGCACTCAGTGG - Intergenic
922772896 1:228197928-228197950 GTCCTAATCTTAGCATTTCCAGG + Intergenic
922848010 1:228705178-228705200 CTCCTAAAGAAGGCTCTTCCAGG - Intergenic
1063727265 10:8651625-8651647 CTCCTAACCATATCACATCCAGG - Intergenic
1068786886 10:60986552-60986574 CTCCTAAGAATAGGACTTACAGG - Intronic
1069852700 10:71420610-71420632 CTACTAATAATAGCACTTATTGG + Intronic
1072464450 10:95650347-95650369 ATCCAAACCATAGCACTTCCAGG - Intronic
1072866153 10:99064138-99064160 CTGCTAATGATATCTATTCCAGG + Intronic
1073051982 10:100673112-100673134 CTCCAAATGATGGCAGTTCCTGG + Intergenic
1076148671 10:128145570-128145592 CTCCTAATGATAGCACCAAGAGG - Intergenic
1086558104 11:88135740-88135762 CTCGTTATGGTAGCTCTTCCTGG - Intronic
1091242275 11:134061611-134061633 ATCCTCATGGTAGAACTTCCTGG - Intergenic
1092851983 12:12637712-12637734 CTCCCATTGATGGCACTTACAGG - Exonic
1093924985 12:24901161-24901183 GTCCTAATGATCTCACATCCTGG - Intronic
1095742682 12:45624015-45624037 CTCCTACTGGTAGCATTTCAAGG + Intergenic
1103393847 12:120592953-120592975 CTCCTAATGCCATCACTTCATGG - Intergenic
1104482416 12:129119560-129119582 CTCCTAATTTTAGCACCTTCAGG - Intronic
1104796532 12:131523917-131523939 CTCCTAATGACACCACTTCAGGG - Intergenic
1106887345 13:34202290-34202312 CTCCAAAGGATGGAACTTCCAGG + Intergenic
1107650042 13:42535834-42535856 CTCCTAATCACAGCATTTCTTGG + Intergenic
1108990120 13:56645088-56645110 CTCCTAATGATATCACTGAGGGG + Intergenic
1111311482 13:86493021-86493043 CTCCTAATGCTATCACTTTAGGG - Intergenic
1111651226 13:91093245-91093267 CTCCTGTTGAGAGCACTTCTGGG + Intergenic
1112198416 13:97249691-97249713 CTCCTAAAGCTCGCACTTCTAGG - Intronic
1115902564 14:38169259-38169281 CTTCCAATGCTACCACTTCCAGG - Intergenic
1117338879 14:54777287-54777309 CTCCTACAGATAGGACTTACTGG - Intronic
1117634985 14:57733079-57733101 CTCCTCATGTTAGCAATTTCTGG - Intronic
1120692691 14:87610981-87611003 CTCTTGATGGAAGCACTTCCTGG + Intergenic
1122021544 14:98841879-98841901 CACCTCATGAAAGCACCTCCTGG + Intergenic
1125906040 15:43393574-43393596 CTCCTAATGCTATCCCTCCCCGG + Intronic
1129830654 15:78667819-78667841 CTCCTAATGTTAGCTCATGCTGG + Intronic
1135470378 16:22724057-22724079 CTCCTAATGCTATCCCTCCCTGG - Intergenic
1138965017 16:62073697-62073719 CTCATAATGATAGCACTCAGAGG + Intergenic
1141361659 16:83400895-83400917 CTACTAATGATAGAAATTGCTGG + Intronic
1141621686 16:85239666-85239688 CTCCTAGTGAGGGCTCTTCCGGG + Intergenic
1142025248 16:87809367-87809389 AAGCTAATGATAGCAGTTCCAGG - Intergenic
1152936569 17:83140701-83140723 CTCCTAATGATCCCACCTCCTGG - Intergenic
1157548881 18:48566850-48566872 GTCTAAATGACAGCACTTCCTGG + Intronic
1161152972 19:2719372-2719394 ATCCTTAGAATAGCACTTCCTGG + Intronic
1164280449 19:23763723-23763745 CTCCTAATCTTAGCACTTTGGGG - Intronic
1164708561 19:30338594-30338616 ATCCTAGTGCTATCACTTCCTGG + Intronic
926362067 2:12098572-12098594 GTCCAAATGATAGCATTTTCAGG - Intergenic
927987297 2:27421112-27421134 TTCCTTATGATAGGACTTACAGG + Intergenic
928540325 2:32278248-32278270 CTCCGGGTGATAGCCCTTCCAGG - Intronic
931729806 2:65143074-65143096 CTCTTACTGATAAGACTTCCTGG - Intergenic
932197665 2:69798168-69798190 CTCCTAATGATAATACTTCCTGG - Intronic
936919661 2:117674777-117674799 CTCCAAATGTTAGCACTTAATGG + Intergenic
941443028 2:165562344-165562366 CTCCTACTGATAAAACTTCTTGG - Intronic
941995226 2:171595675-171595697 CTCCTAATGCCAGCACTCCATGG + Intergenic
943514167 2:188863362-188863384 CTCCAAATGATTGCACTGCCTGG + Intergenic
944111092 2:196131778-196131800 CTCCTAATGATAGCACTTCCTGG - Intergenic
944309153 2:198213787-198213809 TTCCAAAAGATATCACTTCCAGG - Intronic
946836319 2:223776247-223776269 CTCCTGATAATAGCTCTTCAAGG - Intronic
1170788909 20:19491674-19491696 CTCCTCTTGAAAGCACTTCTGGG - Intronic
1173142867 20:40499531-40499553 CGCCTAATGAAACCACTTCAAGG + Intergenic
957382701 3:79453584-79453606 CTACTAATTTTAGCAGTTCCTGG - Intronic
957715729 3:83927990-83928012 CTCTCAATGATGGCACTTCCTGG + Intergenic
959034883 3:101349547-101349569 CTCCTAATGCTATCCCTCCCCGG - Intronic
963999513 3:151753244-151753266 CTCACAGTGATACCACTTCCAGG - Intronic
966399899 3:179537431-179537453 CTCCTAATGCTATCCCTCCCGGG - Intergenic
966689156 3:182725683-182725705 CTCCTAACCATAGCACTTCCTGG - Intergenic
967980861 3:195064504-195064526 CTGCTAATTTTAACACTTCCTGG - Intergenic
971550206 4:27945398-27945420 GTCCTAATTTTAGCACTTGCTGG - Intergenic
974249690 4:59369258-59369280 CTCCTAATGATAGGTCTCTCTGG - Intergenic
975181681 4:71352983-71353005 CTCCTTAAGATGGCTCTTCCTGG - Intronic
975643420 4:76523659-76523681 CTCATGATGATAGCACTGCAGGG + Intronic
980678520 4:136124225-136124247 CTCCAAATGATGGCACAGCCTGG - Intergenic
980795971 4:137683696-137683718 CACCTAATGATACCACATTCTGG - Intergenic
985563370 5:603139-603161 CTCCTAGTGAGGGCCCTTCCTGG + Intergenic
990055589 5:51572785-51572807 CTCCTAATGTCATCACTTCAGGG + Intergenic
996256469 5:121410105-121410127 CTCCTAAAAATAGCACTTCCTGG - Intergenic
996489226 5:124072911-124072933 ATCCTAATTATAGCTCTTTCAGG + Intergenic
996506163 5:124269844-124269866 CTCCTAATATTAGCACACCCTGG - Intergenic
1000193819 5:158938793-158938815 CTCCTAATAATATCACATCGGGG + Intronic
1006733255 6:36252464-36252486 GTCCTACTGATTCCACTTCCTGG - Intronic
1008187520 6:48412231-48412253 CTCCTAGTGTTTCCACTTCCTGG - Intergenic
1008832270 6:55780250-55780272 CTACTAATAATAGCCCTTCCTGG - Intronic
1013844243 6:114430381-114430403 TTCCAAATAATAGCATTTCCAGG - Intergenic
1015800090 6:137051955-137051977 CTTCTAATATTAGCACTCCCAGG - Intergenic
1016088374 6:139944307-139944329 CCCCTAATGAAAGGACTCCCTGG - Intergenic
1016169290 6:140989709-140989731 CTCCTAATGCTATCCCTCCCTGG + Intergenic
1017093680 6:150784569-150784591 ATCCTAATGATAGCCTTTGCTGG - Intronic
1023294550 7:38701297-38701319 CTCCTAATTACAACACTTCATGG - Intergenic
1035917098 8:3636477-3636499 CTCCTAAAGATTTTACTTCCAGG - Intronic
1037072733 8:14672471-14672493 ATTCTAATAATAGCACTTCAGGG - Intronic
1037123329 8:15316182-15316204 CTAGAAATGTTAGCACTTCCTGG - Intergenic
1037475747 8:19255706-19255728 AGCCTAATGATAGCACTGCAAGG + Intergenic
1038382319 8:27107418-27107440 CTCCTAATCATGACACTGCCTGG - Intergenic
1043113029 8:76212314-76212336 TTCCTTATGTTAGCACTTCTTGG + Intergenic
1043841428 8:85108848-85108870 CTCCTGAAGATAGTAGTTCCAGG - Intronic
1044527144 8:93264935-93264957 CTTCTAATGATCTCACATCCAGG + Intergenic
1044915259 8:97106764-97106786 CTCTTAATGATGGAACTGCCAGG - Intronic
1046850625 8:118968751-118968773 CTCCTAATGCTATCCCTCCCTGG + Intergenic
1048437223 8:134429756-134429778 CTTCTAATGGTAGCTCTTTCTGG - Intergenic
1052498912 9:29263286-29263308 CTCCTAATGAAAGAACCTCAGGG - Intergenic
1053423156 9:37993422-37993444 CTCCTAATGCTATCCCTCCCTGG - Intronic
1054844730 9:69782069-69782091 CTCCTAAGGATGGGACTTCCTGG + Intergenic
1055084219 9:72297852-72297874 CTCCAAATGCTAACTCTTCCAGG - Intergenic
1062089902 9:134670396-134670418 CACCTAAGGATAACACTGCCTGG - Intronic
1185980322 X:4772037-4772059 CTCTTAATGATAGTAGTTCTGGG - Intergenic
1186364298 X:8875113-8875135 CTTCTAATGATTGAGCTTCCAGG - Intergenic
1187745892 X:22409049-22409071 CTCCTACTTATAGCAATTCCAGG - Intergenic
1187956681 X:24525332-24525354 CTCCTCCTGACAACACTTCCTGG - Intronic
1191248154 X:58244340-58244362 CTTCTAATGATAGAAACTCCTGG + Intergenic
1192556895 X:72097391-72097413 CTGCTACTGATTGCACTGCCAGG + Intergenic
1193834340 X:86323354-86323376 CTCCTAATGATAACACTTCCTGG - Intronic
1199231950 X:145446122-145446144 CTCCTAATGACATCACTTTTGGG - Intergenic
1201700907 Y:16881033-16881055 CCCCTAATCCTAGCACTTTCGGG + Intergenic
1202021471 Y:20468991-20469013 CTGCTAATAATAACACTTCCTGG - Intergenic