ID: 910192019

View in Genome Browser
Species Human (GRCh38)
Location 1:84604503-84604525
Sequence TCCTAATGATAGCACTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 1, 2: 3, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910192017_910192019 0 Left 910192017 1:84604480-84604502 CCAGATCTGAAAGACTATTTAAC No data
Right 910192019 1:84604503-84604525 TCCTAATGATAGCACTTCCTGGG 0: 2
1: 1
2: 3
3: 11
4: 141
910192016_910192019 21 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192019 1:84604503-84604525 TCCTAATGATAGCACTTCCTGGG 0: 2
1: 1
2: 3
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910192019 Original CRISPR TCCTAATGATAGCACTTCCT GGG Intergenic
905325001 1:37145640-37145662 TCCTGATGAGAGGACTCCCTGGG + Intergenic
905502922 1:38453733-38453755 TCCCCATCACAGCACTTCCTTGG - Intergenic
906582898 1:46951119-46951141 TCCTTAGGATAATACTTCCTAGG + Intergenic
910192019 1:84604503-84604525 TCCTAATGATAGCACTTCCTGGG + Intergenic
912325063 1:108749808-108749830 TTCTAATGATAGAACTGTCTTGG - Intronic
913112932 1:115672207-115672229 TCCTGCTGATTCCACTTCCTTGG + Intronic
914177614 1:145292638-145292660 TGTTCATGATAGAACTTCCTCGG + Intronic
915403844 1:155644171-155644193 TCCCAATGATAGCACTCAGTGGG - Intergenic
915902272 1:159855444-159855466 TGCTAATGATTGCAATGCCTCGG - Intronic
916925869 1:169520249-169520271 TCCAAATTAGAGCCCTTCCTTGG + Intronic
917559189 1:176127512-176127534 TGCAAATGACAGAACTTCCTGGG + Intronic
921836910 1:219787673-219787695 TTCTAAAGCAAGCACTTCCTGGG - Intronic
922772897 1:228197929-228197951 TCCTAATCTTAGCATTTCCAGGG + Intergenic
924622710 1:245676033-245676055 TCCTAATAAAAGCACTGCCATGG - Intronic
1064550157 10:16492411-16492433 GTGTAATGATAGCACTGCCTTGG + Intronic
1068233364 10:54200403-54200425 TCCTAATGCTATCCCTCCCTAGG + Intronic
1068694634 10:59953699-59953721 TCCTAATGTTATCCCTCCCTTGG + Intergenic
1069852701 10:71420611-71420633 TACTAATAATAGCACTTATTGGG + Intronic
1070643419 10:78185170-78185192 CTCTAATAATAGCTCTTCCTCGG - Intergenic
1071253539 10:83845198-83845220 TCCTAATGTTATCCCTTCCCTGG + Intergenic
1075545176 10:123349923-123349945 TCCTAATGAACCCACTGCCTGGG - Intergenic
1077584700 11:3441852-3441874 TCCTGATGATAGCATTTCTATGG + Intergenic
1078622754 11:12923990-12924012 TGCTAATCATACCACTTCCTTGG + Intronic
1079986913 11:27209423-27209445 TCCCAATGATGACTCTTCCTTGG + Intergenic
1084241601 11:67824506-67824528 TCCTGATAATAGCATTTCTTTGG + Intergenic
1084830838 11:71768130-71768152 TCCTGATGATAGCATTTCTATGG - Intergenic
1086555857 11:88110384-88110406 TCCTAATGCTATCCCTTCCCTGG - Intergenic
1087065887 11:94027597-94027619 TCCTTATGATAGCTCTACCATGG + Intronic
1087575999 11:99990512-99990534 TCCTAATGATAAAACTCTCTAGG + Intronic
1088507020 11:110536897-110536919 TTATAAAGATAGCACATCCTTGG - Intergenic
1092411857 12:8259187-8259209 TCCTGATGATAGCATTTCTATGG + Intergenic
1096321570 12:50618638-50618660 TCCTGATCACAGCACTTACTAGG + Intronic
1098572448 12:72003948-72003970 TCATAAAGATAGAACTACCTTGG + Intronic
1098811965 12:75105999-75106021 TCCTAATGATTGAATTTTCTGGG - Intronic
1101830634 12:108253753-108253775 TGCTAAGGAAACCACTTCCTTGG - Intergenic
1103393846 12:120592952-120592974 TCCTAATGCCATCACTTCATGGG - Intergenic
1104398888 12:128459416-128459438 TCCTAAAGAGCCCACTTCCTTGG - Intronic
1104796531 12:131523916-131523938 TCCTAATGACACCACTTCAGGGG - Intergenic
1106004772 13:25758464-25758486 CCATCATAATAGCACTTCCTTGG - Intronic
1106838420 13:33660897-33660919 TCCTAATGGTTTCACTTTCTTGG + Intergenic
1107650043 13:42535835-42535857 TCCTAATCACAGCATTTCTTGGG + Intergenic
1116260296 14:42615854-42615876 TCCTGAAGATAGCCCTTTCTGGG - Intergenic
1117570044 14:57038732-57038754 TCCTTATTATAAAACTTCCTAGG - Intergenic
1121169177 14:91838455-91838477 ACCTAAGGAGAGCACATCCTTGG + Intronic
1121206618 14:92174183-92174205 TGGTCATCATAGCACTTCCTAGG + Intergenic
1123769115 15:23510974-23510996 TCCCAATAATAGCACTCACTGGG - Intergenic
1124667299 15:31604456-31604478 TCCTAATGCTATCCCTCCCTTGG - Intronic
1131560383 15:93434603-93434625 TCCTAATGAAAGCGTTTTCTTGG + Intergenic
1131823507 15:96296503-96296525 AGCTTATGATACCACTTCCTCGG - Intergenic
1133353099 16:5115419-5115441 TCCTGATGATAGCATTTCTATGG + Intergenic
1135470377 16:22724056-22724078 TCCTAATGCTATCCCTCCCTGGG - Intergenic
1138976268 16:62212334-62212356 TCTTAAAGATAGCACACCCTTGG + Intergenic
1140220116 16:73037667-73037689 CCCTAATGATAGCACATGCCAGG - Intronic
1141098714 16:81181308-81181330 TCCAGATGATAGCAATGCCTCGG - Intergenic
1141273317 16:82560465-82560487 CCCTTATGATACAACTTCCTAGG - Intergenic
1142381578 16:89735492-89735514 TCCTGATGGCAGCACTTCCTTGG + Intronic
1143362764 17:6385008-6385030 TCAGAATGATACCACCTCCTTGG + Intergenic
1144875581 17:18395394-18395416 GCCTAAGGATGGCACATCCTGGG + Intergenic
1145156645 17:20549027-20549049 GCCTAAGGATGGCACATCCTGGG - Intergenic
1155549294 18:26948259-26948281 TCCTAATGCTATCACTCCCCTGG - Intronic
1155856765 18:30844420-30844442 TCCTAATGCTAGCCCTCCCCTGG + Intergenic
1157548882 18:48566851-48566873 TCTAAATGACAGCACTTCCTGGG + Intronic
1157713148 18:49863763-49863785 TCCTAATGTTCTCACTTTCTGGG - Intronic
1159142809 18:64418170-64418192 TCCTCATGACAGGAATTCCTGGG + Intergenic
1160072277 18:75639369-75639391 GCCCAACGATAGCACATCCTAGG + Intergenic
1161152973 19:2719373-2719395 TCCTTAGAATAGCACTTCCTGGG + Intronic
1164374836 19:27675527-27675549 TTCTAATGATAGAAATACCTGGG - Intergenic
1166467814 19:43048743-43048765 ATATAGTGATAGCACTTCCTGGG + Intronic
926362066 2:12098571-12098593 TCCAAATGATAGCATTTTCAGGG - Intergenic
927274600 2:21251846-21251868 TCCCTATGACACCACTTCCTTGG - Intergenic
928316376 2:30249777-30249799 TCCTAATGATGGTTCTTACTAGG - Intronic
928327304 2:30329738-30329760 TCCTAATGCTATCCCTTCCCTGG + Intergenic
928902246 2:36332186-36332208 TCCTTATTACAGCATTTCCTTGG - Intergenic
930782947 2:55241529-55241551 TCTTAATGATAGGACTTTCAAGG - Intronic
932197664 2:69798167-69798189 TCCTAATGATAATACTTCCTGGG - Intronic
932461516 2:71884913-71884935 TCATAGTGATAGGACTTCCCAGG - Intergenic
932995692 2:76849223-76849245 TCCAGATGATTGCCCTTCCTTGG - Intronic
937731331 2:125234195-125234217 TATTAATTATTGCACTTCCTAGG + Intergenic
941443027 2:165562343-165562365 TCCTACTGATAAAACTTCTTGGG - Intronic
942545903 2:177063387-177063409 TCCTCATGATGCCTCTTCCTTGG + Intergenic
943653315 2:190480491-190480513 TCATTATGAAAGCTCTTCCTAGG + Intronic
944111091 2:196131777-196131799 TCCTAATGATAGCACTTCCTGGG - Intergenic
947033236 2:225821970-225821992 TCATAATGATAGCATTTCCAAGG - Intergenic
1169990834 20:11500910-11500932 TCCTAATGATACCCCTGCCCCGG + Intergenic
1172687139 20:36764515-36764537 TACTAATGATTGAACTTTCTAGG - Intronic
1173771689 20:45665462-45665484 TCCAAATGATCGCAGCTCCTCGG - Intronic
1182009646 22:26989823-26989845 TTCTGATGATAGCATTTCCCAGG + Intergenic
1182193648 22:28491190-28491212 TCTTAAAGAGAGCACTGCCTTGG + Intronic
1183804190 22:40194221-40194243 GGCTTAAGATAGCACTTCCTGGG + Intronic
1184994353 22:48194375-48194397 TCGTAATGATAACACCTCTTTGG + Intergenic
949573732 3:5318679-5318701 TCCTCATTATAGCACCTTCTGGG - Intergenic
956736284 3:72240966-72240988 TCCTCATGATCACACTTCCCAGG + Intergenic
957715730 3:83927991-83928013 TCTCAATGATGGCACTTCCTGGG + Intergenic
959216841 3:103461515-103461537 CACTAATGTTACCACTTCCTTGG + Intergenic
959395194 3:105828284-105828306 TAGTAAAGATAGCATTTCCTGGG - Intronic
959468756 3:106722351-106722373 TCCTCCAGATACCACTTCCTTGG + Intergenic
961889404 3:130117796-130117818 TCCTGATGATAGCATTTCTATGG + Intergenic
966689155 3:182725682-182725704 TCCTAACCATAGCACTTCCTGGG - Intergenic
968314875 3:197715516-197715538 TCCTCATCATAGCACATACTAGG + Intronic
969814013 4:9673162-9673184 TCCTGATGATAGCATTTCTATGG - Intergenic
972971434 4:44581431-44581453 TCCCAATGAAACCCCTTCCTGGG - Intergenic
973071158 4:45860457-45860479 CCCTGATGATAGCAGCTCCTTGG - Intergenic
974280486 4:59785304-59785326 TCCTAATGCTATCCCTTCCCTGG - Intergenic
974752847 4:66163966-66163988 TTCTGAGGATAGCACTTCCCAGG + Intergenic
976440459 4:85067383-85067405 TACTAATGTTAGCACTTCATCGG - Intergenic
976474937 4:85473290-85473312 TCCAACTGATAGCACTTCATTGG - Intergenic
977731713 4:100361484-100361506 TCCACATGCTTGCACTTCCTGGG + Intergenic
982207778 4:153010001-153010023 TCATATAGATAACACTTCCTTGG - Intergenic
989194045 5:38698808-38698830 TCCAACTCATAGCACTTCCCTGG + Intergenic
996256468 5:121410104-121410126 TCCTAAAAATAGCACTTCCTGGG - Intergenic
996428904 5:123348383-123348405 TCCAAAATATAGCACTTTCTTGG - Intronic
996506162 5:124269843-124269865 TCCTAATATTAGCACACCCTGGG - Intergenic
997611414 5:135218272-135218294 TCAAAAAGACAGCACTTCCTAGG - Intronic
997614731 5:135238630-135238652 CCCTAAGAATACCACTTCCTGGG + Intronic
1006615367 6:35322478-35322500 TCCAACTGATTGGACTTCCTTGG + Intergenic
1009484122 6:64198455-64198477 TCCTAATGCTAGCCCTCCCCTGG + Intronic
1014420115 6:121233618-121233640 TCCTGAAGATAGCAGTACCTTGG + Intronic
1015007726 6:128303832-128303854 TCATAATGATTGCAGTTCCAAGG + Intronic
1016826166 6:148390334-148390356 TCCCAGTGCTAGCTCTTCCTGGG + Intronic
1021231078 7:18086806-18086828 TGCTAAAAATAGCACTTCTTGGG - Intergenic
1024390962 7:48811589-48811611 TCCTAATGATCAGGCTTCCTGGG + Intergenic
1028197372 7:87922488-87922510 TCCTGAAGACAGCACTTACTTGG - Intergenic
1028424117 7:90667233-90667255 ACCAAATTATAGCAATTCCTTGG + Intronic
1030802100 7:113864736-113864758 ACATAATGATAGTACTTCTTTGG + Intergenic
1031608632 7:123798792-123798814 TCCTAAATATGCCACTTCCTTGG - Intergenic
1032645849 7:133823345-133823367 TCCTAAAAATACCACTTCCCAGG + Intronic
1036377338 8:8212256-8212278 TCCTGATGATAGCATTTCTATGG - Intergenic
1036852213 8:12210895-12210917 TCCTGATGATAGCATTTCTATGG + Intergenic
1036873580 8:12453416-12453438 TCCTGATGATAGCATTTCTATGG + Intergenic
1037123328 8:15316181-15316203 TAGAAATGTTAGCACTTCCTGGG - Intergenic
1037475748 8:19255707-19255729 GCCTAATGATAGCACTGCAAGGG + Intergenic
1037804402 8:22050965-22050987 CCCTAATGATGGCACTTCAGAGG + Intronic
1040906524 8:52474666-52474688 TCCTAAGAATAGAACATCCTCGG - Intergenic
1041712453 8:60906782-60906804 TATTAATAATAGTACTTCCTTGG + Intergenic
1043113030 8:76212315-76212337 TCCTTATGTTAGCACTTCTTGGG + Intergenic
1046897686 8:119490271-119490293 TCCTGGTGCTAACACTTCCTGGG + Intergenic
1048384950 8:133903524-133903546 TCCTCATGAGAGCACTTCAATGG - Intergenic
1051698854 9:19797467-19797489 TGCTAATGAAAGCTCTTGCTTGG + Intergenic
1053423155 9:37993421-37993443 TCCTAATGCTATCCCTCCCTGGG - Intronic
1054731164 9:68704587-68704609 TCCTACTGATAGCGCTTAGTGGG - Intergenic
1054844731 9:69782070-69782092 TCCTAAGGATGGGACTTCCTGGG + Intergenic
1055947807 9:81707142-81707164 TCCTTATGAAAGAGCTTCCTAGG - Intergenic
1058714143 9:107708359-107708381 TCCTATTGATTGCAAGTCCTTGG + Intergenic
1062089901 9:134670395-134670417 ACCTAAGGATAACACTGCCTGGG - Intronic
1187745891 X:22409048-22409070 TCCTACTTATAGCAATTCCAGGG - Intergenic
1188579686 X:31695597-31695619 TCCAAATGACAGAATTTCCTAGG - Intronic
1189101093 X:38190745-38190767 GCCTGGTGCTAGCACTTCCTAGG + Intronic
1191246151 X:58229862-58229884 TCCTAATGATAAAACCACCTGGG + Intergenic
1192013685 X:67303689-67303711 TCCTAATGCTATCCCTTCCCTGG - Intergenic
1193834339 X:86323353-86323375 TCCTAATGATAACACTTCCTGGG - Intronic
1194578914 X:95646895-95646917 TTCAAATGATAGCACTGCCATGG + Intergenic
1198760880 X:140031381-140031403 TCCTAATGCTATCCCTCCCTTGG + Intergenic
1202021470 Y:20468990-20469012 TGCTAATAATAACACTTCCTGGG - Intergenic
1202040714 Y:20680433-20680455 TCCTAATGCTATCCCTTCCCTGG - Intergenic
1202172427 Y:22065015-22065037 TCTCATTGATAGCACTTTCTGGG - Intergenic
1202218936 Y:22521356-22521378 TCTCATTGATAGCACTTTCTGGG + Intergenic
1202324250 Y:23674695-23674717 TCTCATTGATAGCACTTTCTGGG - Intergenic
1202546521 Y:25995359-25995381 TCTCATTGATAGCACTTTCTGGG + Intergenic