ID: 910192021

View in Genome Browser
Species Human (GRCh38)
Location 1:84604504-84604526
Sequence CCTAATGATAGCACTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 1, 2: 3, 3: 13, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910192016_910192021 22 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192021 1:84604504-84604526 CCTAATGATAGCACTTCCTGGGG 0: 2
1: 1
2: 3
3: 13
4: 106
910192017_910192021 1 Left 910192017 1:84604480-84604502 CCAGATCTGAAAGACTATTTAAC No data
Right 910192021 1:84604504-84604526 CCTAATGATAGCACTTCCTGGGG 0: 2
1: 1
2: 3
3: 13
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910192021 Original CRISPR CCTAATGATAGCACTTCCTG GGG Intergenic
900210498 1:1453456-1453478 TGTAATCATAGCACTTTCTGAGG - Intronic
900737975 1:4311040-4311062 GCTTATGATAACACTACCTGGGG + Intergenic
908420439 1:63953728-63953750 CCTAATGAAGGCCCTTACTGTGG - Intronic
910192021 1:84604504-84604526 CCTAATGATAGCACTTCCTGGGG + Intergenic
912747280 1:112255482-112255504 CCTAATCACAGCCCTTCCAGAGG + Intergenic
915109636 1:153554857-153554879 CCTAATGATAGCTCCTCTCGGGG + Intergenic
917011268 1:170474959-170474981 GATAATGATAGGACTTCCTGTGG - Intergenic
917393338 1:174563740-174563762 CCTAATGCTAGCATCTCCAGTGG + Intronic
918409111 1:184240260-184240282 CCTCATTCTAGCACTTCCTTTGG + Intergenic
921649443 1:217659010-217659032 CCTGATGATATTACTGCCTGGGG + Intronic
923293110 1:232566241-232566263 CTCAATGAAAGCACTTTCTGAGG - Intergenic
923493341 1:234503774-234503796 GCTAATTCTAGTACTTCCTGAGG + Intergenic
924036835 1:239946262-239946284 TCTAATGTTAGTACTTGCTGTGG + Intergenic
924458225 1:244235040-244235062 TCTGATGATAACAATTCCTGAGG - Intergenic
1063092551 10:2880066-2880088 CCTAATGATATCCCTTCCCCAGG + Intergenic
1066554068 10:36592001-36592023 GCCGATGATAGCACCTCCTGTGG + Intergenic
1075545174 10:123349922-123349944 CCTAATGAACCCACTGCCTGGGG - Intergenic
1078862000 11:15257090-15257112 CTTAATGATAGAACCTGCTGAGG + Intergenic
1079016608 11:16874248-16874270 TGTAATCCTAGCACTTCCTGAGG + Intronic
1087424748 11:97971951-97971973 CCCAATGATGACACTTCCTGAGG - Intergenic
1088682882 11:112259400-112259422 CATAATAATAACACTTCCTATGG - Intronic
1091999349 12:5019741-5019763 CCTCATGATAGCACTGTTTGAGG + Intergenic
1096413577 12:51393933-51393955 CAGAATGAGGGCACTTCCTGTGG + Intronic
1099934446 12:89108501-89108523 GCTAATGATAGGACTTACAGTGG - Intergenic
1102572262 12:113834069-113834091 TCTAATGATACCAAGTCCTGCGG - Intronic
1105409170 13:20156792-20156814 CTTAATGTTAGAACTCCCTGTGG - Intronic
1109484654 13:63002483-63002505 CCTAAGGATGGGCCTTCCTGAGG - Intergenic
1110616195 13:77544673-77544695 TCTAATAACAGCACTTCCTCTGG - Intronic
1115377061 14:32688485-32688507 CCAAATCATAGCCCTTCTTGAGG - Intronic
1116260294 14:42615853-42615875 CCTGAAGATAGCCCTTTCTGGGG - Intergenic
1123173079 14:106392197-106392219 CATACTGATTGCACTTCCTGTGG + Intergenic
1123769113 15:23510973-23510995 CCCAATAATAGCACTCACTGGGG - Intergenic
1128082068 15:64862574-64862596 CCTAAATGTAGCACTTGCTGAGG - Intronic
1137881309 16:52051311-52051333 CCTGATGATAGCTCTTTCTCTGG - Intronic
1139931145 16:70527557-70527579 CCTCATTATGGCTCTTCCTGCGG + Intronic
1140220114 16:73037666-73037688 CCTAATGATAGCACATGCCAGGG - Intronic
1142381580 16:89735493-89735515 CCTGATGGCAGCACTTCCTTGGG + Intronic
1143396531 17:6603366-6603388 CATAATGATAGGACTTATTGTGG - Intronic
1143852942 17:9826180-9826202 CCCAGAGAGAGCACTTCCTGTGG - Exonic
1144875583 17:18395395-18395417 CCTAAGGATGGCACATCCTGGGG + Intergenic
1145156643 17:20549026-20549048 CCTAAGGATGGCACATCCTGGGG - Intergenic
1145185096 17:20787214-20787236 CCTAAGTATAGAACTGCCTGGGG + Intergenic
1157221781 18:45833267-45833289 GCTAATGATAGCACCTGATGGGG + Intronic
1157713146 18:49863762-49863784 CCTAATGTTCTCACTTTCTGGGG - Intronic
1159578672 18:70210075-70210097 CCTACTAATAGGACTGCCTGGGG + Intergenic
1161444556 19:4310968-4310990 CCTGAGAATAGCACGTCCTGTGG + Intronic
1164814625 19:31185789-31185811 GATAATGATGGAACTTCCTGGGG - Intergenic
926530809 2:14042351-14042373 TTTAATTATAGCAATTCCTGTGG + Intergenic
929257142 2:39824610-39824632 CATACTGATATCACTTCCTTTGG + Intergenic
932197662 2:69798166-69798188 CCTAATGATAATACTTCCTGGGG - Intronic
932419604 2:71593781-71593803 CCTCATGATAGAGCTGCCTGAGG - Intronic
932587836 2:73043307-73043329 CCTACTGAGGGCCCTTCCTGAGG - Intronic
942222843 2:173788203-173788225 CGTCATGATAGGTCTTCCTGGGG + Intergenic
942786381 2:179707000-179707022 CCCACTGATAGCACATCATGGGG - Intronic
943779985 2:191812902-191812924 CCTAGTGAAAGAATTTCCTGTGG - Intergenic
943926892 2:193795818-193795840 CCTAATGATAGCATCTCATGAGG - Intergenic
944111089 2:196131776-196131798 CCTAATGATAGCACTTCCTGGGG - Intergenic
944645084 2:201771755-201771777 CCTAATCATAAAACTTCCTCTGG + Intronic
948608774 2:239154009-239154031 CCAAATGTCAGCACTACCTGGGG - Intronic
1170253113 20:14308254-14308276 CCTAATGACAGATCTTTCTGAGG - Intronic
1183804191 22:40194222-40194244 GCTTAAGATAGCACTTCCTGGGG + Intronic
950166431 3:10803874-10803896 CCCAGTGATAGCCCTTCCTTTGG - Intergenic
951608052 3:24459088-24459110 CCTAATGTTATCCCTTCCTTAGG + Intronic
953251129 3:41246625-41246647 GCTAAGGTTAGCACTGCCTGTGG - Exonic
956040403 3:65139322-65139344 AATAATGGTAGCACTTCCAGAGG + Intergenic
956224058 3:66936103-66936125 AATAATGTTAGCTCTTCCTGTGG - Intergenic
957715731 3:83927992-83928014 CTCAATGATGGCACTTCCTGGGG + Intergenic
965751075 3:171975635-171975657 CCAAATGAGAGCAGTTTCTGAGG + Intergenic
966689153 3:182725681-182725703 CCTAACCATAGCACTTCCTGGGG - Intergenic
971924300 4:32986957-32986979 ACTAATGACAGCACTGGCTGTGG + Intergenic
974489494 4:62546499-62546521 TCTAATTATTGTACTTCCTGAGG + Intergenic
976289675 4:83404706-83404728 ACTAATGAGAACCCTTCCTGGGG + Intergenic
979293079 4:118999675-118999697 ACTAATAATACCTCTTCCTGGGG + Intronic
981748979 4:148075369-148075391 CCTAATGACATCACATTCTGAGG - Intergenic
984564795 4:181316349-181316371 TATAATGATATCACTTGCTGAGG + Intergenic
991461114 5:66860203-66860225 CATAAAAATAGCATTTCCTGGGG + Intronic
995382596 5:111551269-111551291 ACTGCTAATAGCACTTCCTGAGG - Intergenic
995904813 5:117110785-117110807 CTTCATGCTAGCACTCCCTGTGG - Intergenic
996256466 5:121410103-121410125 CCTAAAAATAGCACTTCCTGGGG - Intergenic
996506160 5:124269842-124269864 CCTAATATTAGCACACCCTGGGG - Intergenic
998855812 5:146394312-146394334 CTTATTGATAGAACATCCTGGGG + Intergenic
1002004403 5:176220653-176220675 CCTAATTATAGCTATTCCAGTGG - Intergenic
1004723233 6:18287438-18287460 CCTAATGATGGAACTTCTTGCGG + Intergenic
1005166351 6:22926041-22926063 CCAAATGGTAGCAATCCCTGAGG - Intergenic
1005686313 6:28256163-28256185 TGTAATGCTAGCACTTTCTGAGG + Intergenic
1007047442 6:38791887-38791909 CCTAATGCTGGCGTTTCCTGGGG + Intronic
1009389625 6:63130389-63130411 CCTAAGGATGGAGCTTCCTGAGG + Intergenic
1009821808 6:68812523-68812545 GCTAATGTTACCATTTCCTGTGG + Intronic
1016492726 6:144625104-144625126 CCTAATGAAAGTACTTCATTAGG - Intronic
1016826168 6:148390335-148390357 CCCAGTGCTAGCTCTTCCTGGGG + Intronic
1017067501 6:150542959-150542981 CCCAGTGTTAGCACCTCCTGGGG + Intergenic
1017651860 6:156590778-156590800 GCTAATGATACAAATTCCTGAGG + Intergenic
1017740971 6:157406336-157406358 CCTACTTATAGCAATACCTGAGG - Intronic
1021231077 7:18086805-18086827 GCTAAAAATAGCACTTCTTGGGG - Intergenic
1023279018 7:38550867-38550889 CAGAATGATTCCACTTCCTGTGG - Intronic
1023566320 7:41526961-41526983 CCTAATCATAGAATATCCTGAGG - Intergenic
1023796586 7:43798291-43798313 ACTAATGATATCACTTCATTAGG + Intronic
1024289325 7:47790143-47790165 CGTAATCATAGCACTTCGGGAGG - Intronic
1024318407 7:48042756-48042778 CAAAATGATAGCAGTGCCTGTGG - Intronic
1029193613 7:98788994-98789016 CATAATAATATCACTGCCTGCGG + Intergenic
1032513511 7:132490680-132490702 CGTAATGCTAGCACTTCGGGAGG - Intronic
1032749122 7:134819277-134819299 CCTTAGGATACCACTTCCTAAGG + Intronic
1037475750 8:19255708-19255730 CCTAATGATAGCACTGCAAGGGG + Intergenic
1037658173 8:20905311-20905333 CATTATCATAGCCCTTCCTGTGG + Intergenic
1039153656 8:34531269-34531291 TCTAATTAAATCACTTCCTGAGG - Intergenic
1041909524 8:63073548-63073570 CTGAATGATAGCAATTCATGTGG + Intronic
1050433646 9:5586952-5586974 CCTCATGATTGCACTTTCTCAGG - Intergenic
1050714822 9:8510728-8510750 CCTAACGATATCACTTCCTCAGG + Intronic
1052604044 9:30675335-30675357 CCTCATGATAGCAAATCCTAAGG + Intergenic
1062089899 9:134670394-134670416 CCTAAGGATAACACTGCCTGGGG - Intronic
1189745762 X:44167389-44167411 TTTAATGATAGGACTTCGTGTGG - Intronic
1191247290 X:58237960-58237982 CCTAATGATAGGGACTCCTGTGG + Intergenic
1193241601 X:79176528-79176550 CCTAATGACAGCCTTCCCTGTGG - Intergenic
1193834337 X:86323352-86323374 CCTAATGATAACACTTCCTGGGG - Intronic
1193953905 X:87835206-87835228 CCTACTGATACCACTGCCAGAGG - Intergenic
1194176337 X:90653177-90653199 GAAAATGATAGCACTTTCTGTGG + Intergenic
1194176347 X:90653308-90653330 GAAAATGATAGCACTTTCTGTGG + Intergenic
1194667556 X:96692501-96692523 CTTTATGATAGCACTTTATGTGG - Intronic
1195968971 X:110454020-110454042 CCGAAGGATGGCACTTCCTTTGG - Exonic
1198251299 X:134881672-134881694 CCTGATGATAGGACTCCATGGGG - Intergenic
1198440421 X:136657929-136657951 CCTAATTTTAGTACTTGCTGTGG - Intronic
1200522959 Y:4234097-4234119 GAAAATGATAGCACTTTCTGTGG + Intergenic
1200522969 Y:4234228-4234250 GAAAATGATAGCACTTTCTGTGG + Intergenic
1201700911 Y:16881035-16881057 CCTAATCCTAGCACTTTCGGGGG + Intergenic
1202021469 Y:20468989-20469011 GCTAATAATAACACTTCCTGGGG - Intergenic