ID: 910192022

View in Genome Browser
Species Human (GRCh38)
Location 1:84604508-84604530
Sequence ATGATAGCACTTCCTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 1, 2: 3, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910192016_910192022 26 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192022 1:84604508-84604530 ATGATAGCACTTCCTGGGGTTGG 0: 2
1: 1
2: 3
3: 11
4: 151
910192017_910192022 5 Left 910192017 1:84604480-84604502 CCAGATCTGAAAGACTATTTAAC No data
Right 910192022 1:84604508-84604530 ATGATAGCACTTCCTGGGGTTGG 0: 2
1: 1
2: 3
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910192022 Original CRISPR ATGATAGCACTTCCTGGGGT TGG Intergenic
903441328 1:23390132-23390154 AAGATAGGAGTTCCTGGGGTGGG + Intronic
904561552 1:31401445-31401467 ATGAAACTACTTCCTGTGGTTGG - Intergenic
907409495 1:54274430-54274452 CTGAGAGCACTGGCTGGGGTGGG + Intronic
910192022 1:84604508-84604530 ATGATAGCACTTCCTGGGGTTGG + Intergenic
912537676 1:110387761-110387783 CTGAGAGCCCTTCCTGGGGCTGG - Intronic
915958167 1:160240763-160240785 ATGCTAGCTCTTGCTGGAGTTGG - Intronic
922256672 1:223898488-223898510 AGGATAGCACTACATTGGGTGGG + Intergenic
922830922 1:228553757-228553779 ATCATTACAATTCCTGGGGTTGG + Intergenic
923330946 1:232924157-232924179 AAGATAGCACACCCTTGGGTTGG - Intergenic
923624078 1:235599973-235599995 CTAAAATCACTTCCTGGGGTAGG - Intronic
1063396339 10:5691833-5691855 TTGATACCAATGCCTGGGGTAGG - Intronic
1069636422 10:69927800-69927822 TTGATAGCAATTTCTGGGATTGG - Intronic
1070779611 10:79129921-79129943 AAGATAGGGCTTCCTGGGGGAGG + Intronic
1071474847 10:86017415-86017437 AAGTCAGCACTTACTGGGGTGGG - Intronic
1071604830 10:86978534-86978556 ATCCTAGCACTTGCTGAGGTGGG + Intronic
1073248270 10:102106731-102106753 GTGTTAGCACTTCCTGGGACTGG + Intergenic
1075446562 10:122517517-122517539 ATGATAGCATTTCCATGGGCTGG + Intergenic
1078078158 11:8180385-8180407 ATGAAAGAACTCCCTAGGGTGGG + Intergenic
1078530398 11:12132365-12132387 AGCATAGCACTGCCTGGTGTTGG - Intronic
1079016609 11:16874252-16874274 ATCCTAGCACTTCCTGAGGCTGG + Intronic
1083296624 11:61718704-61718726 ATGATGTCACTTCCTGAGGGTGG + Intronic
1083510857 11:63208533-63208555 CTGATAGGAAGTCCTGGGGTAGG + Intronic
1085324338 11:75595138-75595160 CTGCTCGCACTGCCTGGGGTGGG + Intronic
1087424746 11:97971947-97971969 ATGATGACACTTCCTGAGGTTGG - Intergenic
1090411628 11:126513372-126513394 ATGGTGGCACTGGCTGGGGTAGG + Intronic
1093647549 12:21604898-21604920 AGGTAAGCACTTCCTGGGATAGG + Intergenic
1094483415 12:30903735-30903757 ATGATAGCACTTTCTGGAAGAGG + Intergenic
1095518571 12:43035008-43035030 ATGATATCACGTACTGTGGTAGG - Intergenic
1102417121 12:112773645-112773667 ATTTTTGCACTTCCTGGTGTTGG + Intronic
1105067744 12:133215482-133215504 ATGATTCCACTTCCTGGAGCTGG - Intergenic
1108288446 13:48932558-48932580 ATGGTAGCTCTTCCTGCAGTTGG + Intergenic
1109398417 13:61791691-61791713 ATGATTGCACTTATTGGGCTAGG - Intergenic
1115123202 14:29961521-29961543 ATGATAGCACTGCCTGCATTAGG - Intronic
1115351588 14:32401190-32401212 CTGATAGCTCTTCCTTGGCTAGG + Intronic
1117261217 14:54035621-54035643 ATGATACCTTTTCCTTGGGTTGG + Intergenic
1119394974 14:74319533-74319555 ATGGTACCATTTACTGGGGTTGG + Intronic
1122834276 14:104423448-104423470 ATGGCATCACTCCCTGGGGTGGG + Intergenic
1123769111 15:23510969-23510991 ATAATAGCACTCACTGGGGTTGG - Intergenic
1124474755 15:30023150-30023172 CTGCTTGCACTTCCTGGGGGAGG + Intergenic
1135411426 16:22237920-22237942 ATGATACCACTTACTGGTGGCGG - Intronic
1135965492 16:27031683-27031705 AGGAAGGGACTTCCTGGGGTAGG - Intergenic
1137047911 16:35685672-35685694 ATCATTACACTGCCTGGGGTTGG + Intergenic
1137048782 16:35691137-35691159 ATCATTGCACTACCTGGGGTTGG + Intergenic
1137052472 16:35725672-35725694 ATTATAAGACTACCTGGGGTTGG + Intergenic
1137053073 16:35729495-35729517 ATCATTAGACTTCCTGGGGTCGG + Intergenic
1141361660 16:83400901-83400923 ATGATAGAAATTGCTGGTGTTGG + Intronic
1142741974 17:1936730-1936752 CTGATTGCGGTTCCTGGGGTTGG + Exonic
1143517844 17:7428946-7428968 GTCCTGGCACTTCCTGGGGTTGG - Intergenic
1147788834 17:43000179-43000201 ATGATATCCCTTCCTGGTGTTGG - Intronic
1147919438 17:43907094-43907116 CTGTTAGCGCTTCCGGGGGTTGG - Intronic
1148582650 17:48754269-48754291 CTGAAAGCTCTTCCTGGGTTTGG + Intergenic
1151128530 17:71871634-71871656 CTTATAGCACTTCTTGGGGCGGG - Intergenic
1151997722 17:77620807-77620829 AAGATGGGAGTTCCTGGGGTTGG + Intergenic
1157147815 18:45183274-45183296 CTGATAACACCTCTTGGGGTAGG + Intergenic
1158623954 18:59056052-59056074 TTGATAGCACATCCTGGTATTGG + Intergenic
1161152977 19:2719378-2719400 AGAATAGCACTTCCTGGGAGGGG + Intronic
1161261724 19:3341531-3341553 CTGGTAGCACTTCCTGTGTTTGG - Intergenic
1162320026 19:9966267-9966289 GGGACAGCACTTCCTGGGGGAGG + Intronic
1164374895 19:27675958-27675980 ATTATTAGACTTCCTGGGGTAGG + Intergenic
1164376182 19:27690381-27690403 ATCATTGGACTGCCTGGGGTTGG + Intergenic
1164381352 19:27739323-27739345 ATCATCACACTGCCTGGGGTTGG + Intergenic
1164383120 19:27752151-27752173 ATTATAAGACTGCCTGGGGTCGG + Intergenic
1164384213 19:27759669-27759691 ATGATTAGACTGCCTGGGGTCGG + Intergenic
1164384550 19:27761837-27761859 ATCATCACACTGCCTGGGGTTGG + Intergenic
1164385236 19:27766215-27766237 ATGATGAGACTGCCTGGGGTCGG + Intergenic
1164386018 19:27771174-27771196 ATGATTAGACTGCCTGGGGTTGG + Intergenic
1166747006 19:45146216-45146238 CTGGGAGCTCTTCCTGGGGTGGG + Intronic
1168207964 19:54866191-54866213 TTGAGAGCACTTCATGGGATGGG + Intronic
925700680 2:6634313-6634335 ATGAGCCCCCTTCCTGGGGTAGG - Intergenic
926910795 2:17850963-17850985 ATGACACCATTTCCAGGGGTGGG + Intergenic
927847548 2:26479372-26479394 ATGGAAGTAGTTCCTGGGGTGGG + Exonic
928614219 2:33020301-33020323 AGGAGAGCACTTTTTGGGGTTGG + Intronic
929536740 2:42788547-42788569 GTGATAGTCCTTCCTGGTGTTGG + Exonic
929946547 2:46376717-46376739 ATGATGGCGTCTCCTGGGGTGGG - Exonic
930060825 2:47286974-47286996 AGTATACCAATTCCTGGGGTGGG - Intergenic
930315067 2:49787228-49787250 ATGATATCACTTCCCAGGTTAGG - Intergenic
932197661 2:69798162-69798184 ATGATAATACTTCCTGGGGTTGG - Intronic
933517353 2:83322014-83322036 ATGATGGAACTTGCTGGGTTTGG - Intergenic
936919663 2:117674783-117674805 ATGTTAGCACTTAATGGTGTTGG + Intergenic
937059819 2:118972554-118972576 ATGGTAGGACTTCCTAGGATTGG + Intronic
938838547 2:135134943-135134965 ATGCTAGTACTTCCTGGAGTGGG + Intronic
939863788 2:147449935-147449957 ATGACAGCATTTTCTGGGTTGGG - Intergenic
941864655 2:170322181-170322203 CTGTTGTCACTTCCTGGGGTGGG - Intronic
942151915 2:173084361-173084383 ATGATAGCACTCACTTTGGTAGG - Intronic
943516003 2:188887403-188887425 ATAATAACACATCCTGAGGTTGG - Intergenic
944111088 2:196131772-196131794 ATGATAGCACTTCCTGGGGTTGG - Intergenic
947589119 2:231374944-231374966 CTGATAGCACAGCCTGGGGCTGG + Intergenic
1171513480 20:25706975-25706997 ATGCTTGCACTTCCTGGGTGAGG + Intergenic
1178805825 21:35838221-35838243 ATAACAGCACATTCTGGGGTAGG + Intronic
1184729530 22:46365093-46365115 ATGAAAGGACAGCCTGGGGTGGG - Intronic
1185252890 22:49814693-49814715 CTGAGAGCACCTCCTGGGCTCGG - Intronic
949796615 3:7858736-7858758 ATAATGGCACTGCCTGGAGTTGG - Intergenic
949796634 3:7858907-7858929 ATAATGGCACTACCTGGAGTTGG - Intergenic
955146033 3:56320772-56320794 ATGATGACAATTCCTGAGGTGGG + Intronic
957715732 3:83927996-83928018 ATGATGGCACTTCCTGGGGTTGG + Intergenic
960284631 3:115813869-115813891 ATGAAAGCACTTGCTGAGCTTGG - Intronic
961484851 3:127209509-127209531 AGGATCACACTGCCTGGGGTGGG + Intergenic
961819530 3:129568278-129568300 ATTATAACCTTTCCTGGGGTGGG + Intronic
962508502 3:136073265-136073287 ATCATAAAACTTCCTGGGGATGG - Intronic
965547362 3:169930265-169930287 TTGCTACCACTTCTTGGGGTAGG - Intronic
966689152 3:182725677-182725699 ACCATAGCACTTCCTGGGGTTGG - Intergenic
970441780 4:16086208-16086230 CTAACAGCACTACCTGGGGTTGG - Intergenic
971237503 4:24855915-24855937 ATCATGCCACTTCCTGGGTTGGG + Intronic
971433581 4:26594685-26594707 ACGTTAGCATTTCATGGGGTAGG - Intronic
974928728 4:68335657-68335679 ATGAAACCACTCCCTTGGGTAGG - Intronic
975338480 4:73208957-73208979 ATCCCAGCACTTCCGGGGGTGGG + Intronic
976888636 4:90016634-90016656 AGTATATCACTTCCTGGGGGAGG - Intergenic
977412766 4:96689337-96689359 AACATGGCACTTCTTGGGGTTGG - Intergenic
977731716 4:100361489-100361511 ATGCTTGCACTTCCTGGGATGGG + Intergenic
984232934 4:177121173-177121195 ATTATAACACTTCCTGGTGTGGG + Intergenic
986216300 5:5722293-5722315 CTGAAGGCCCTTCCTGGGGTGGG + Intergenic
986987903 5:13520063-13520085 ATGTAAACACATCCTGGGGTGGG - Intergenic
987317324 5:16735705-16735727 ATAATAGCATTTTCTGGGTTTGG - Intronic
991510805 5:67374803-67374825 ATCATAGCATTTCATGGTGTTGG + Intergenic
992887018 5:81169187-81169209 ATGATACCACTTCCTGAGATGGG - Intronic
994493540 5:100479525-100479547 ATGATAGCAATTCATAGAGTAGG - Intergenic
997611710 5:135220247-135220269 CTTGTTGCACTTCCTGGGGTAGG - Intronic
997674422 5:135702065-135702087 ATCATAGCAATTGCAGGGGTGGG + Intergenic
998461047 5:142310316-142310338 AAGATAGGGCTTCCTGGGCTGGG - Intergenic
999258998 5:150226439-150226461 ATTAAAGTATTTCCTGGGGTGGG + Intronic
999569197 5:152899378-152899400 AAGAAAGCACTCCATGGGGTTGG - Intergenic
1000174682 5:158739844-158739866 GTCACAGCACTTGCTGGGGTGGG - Intronic
1001221947 5:169908059-169908081 ATGAAAGCTTTTCCTGGGGATGG - Intronic
1001513370 5:172338709-172338731 AGGAGAGCACGGCCTGGGGTGGG + Exonic
1007091070 6:39185278-39185300 ATGACAGTGCTCCCTGGGGTGGG + Intergenic
1011064848 6:83313938-83313960 ATGAAAGCACTTTCTGCTGTTGG + Intronic
1013267280 6:108512322-108512344 TTGATAGCACTCCCTTAGGTGGG - Intronic
1013724844 6:113081786-113081808 CTGAAATCACTTCCTAGGGTGGG + Intergenic
1016859464 6:148702375-148702397 TTTATAGTACTTCCTGGAGTTGG + Intergenic
1021231075 7:18086801-18086823 AAAATAGCACTTCTTGGGGAGGG - Intergenic
1033834582 7:145293656-145293678 ATGATAGCACATCCTGCAGCTGG - Intergenic
1036824515 8:11965747-11965769 GTGATAACACTCCCGGGGGTGGG - Intergenic
1037628323 8:20628297-20628319 ATAGCAGCACTTCCTGGGGTAGG + Intergenic
1038280665 8:26161327-26161349 ATCATAGCCTTTCCTGGGGGTGG + Intergenic
1039383347 8:37106822-37106844 ATGACAGCACTTACTGGGCAGGG - Intergenic
1042030971 8:64475078-64475100 AAGATAGCATTCCCTGGGCTTGG - Intergenic
1042267393 8:66923642-66923664 ATCCTAGCACTTTGTGGGGTCGG + Intergenic
1043492931 8:80767116-80767138 ATGATAGCACTCACTGGAATGGG - Intronic
1044016663 8:87054404-87054426 ATGATAGCCCTCAATGGGGTTGG - Intronic
1045880412 8:107031204-107031226 GTGACAGTACTTACTGGGGTAGG - Intergenic
1047830367 8:128622802-128622824 TGGATAGCAGTTCCTGGAGTGGG - Intergenic
1047961375 8:130014516-130014538 ATAGTAGCACTTACGGGGGTCGG + Intronic
1049423526 8:142527114-142527136 CTGAGAGCACTCCCTGGGCTTGG - Intronic
1049976682 9:866748-866770 AAGGTAGCAGCTCCTGGGGTGGG - Intronic
1050371050 9:4921621-4921643 ATGTTTACACTTCCAGGGGTTGG + Intergenic
1051101723 9:13529851-13529873 CTGCCACCACTTCCTGGGGTGGG - Intergenic
1052636514 9:31113107-31113129 ATGATGGCACTTCGAGAGGTTGG - Intergenic
1053361049 9:37486775-37486797 TTGATTCCTCTTCCTGGGGTTGG - Exonic
1056036699 9:82613989-82614011 ATTATATCACTTCCTGGGTTTGG - Intergenic
1058963854 9:110018237-110018259 ATGAAAAATCTTCCTGGGGTAGG - Intronic
1059559851 9:115323778-115323800 ATAATAGCAATGCCTGTGGTGGG + Intronic
1060775214 9:126368000-126368022 ATGATGGCACATGCTGGGGAGGG + Intronic
1061871809 9:133524853-133524875 AGGAAAGCACTGGCTGGGGTGGG + Exonic
1186865210 X:13713565-13713587 ATCCCAGCACTTCCTGAGGTGGG + Intronic
1188764598 X:34076182-34076204 ATGGTACCATTTTCTGGGGTTGG + Intergenic
1189261526 X:39682367-39682389 ATGCCAGCACTTCCTGGGCGGGG - Intergenic
1190427472 X:50346403-50346425 AGGATAGGACCTCCTGGGGGTGG - Intronic
1190878865 X:54478641-54478663 ATAATAGCAGTTCCTTGGTTTGG + Intronic
1191236612 X:58139298-58139320 ACCATAGGACTGCCTGGGGTTGG - Intergenic
1191249383 X:58253220-58253242 ATTATAAGACTGCCTGGGGTTGG - Intergenic
1194074330 X:89369739-89369761 ATGTTTGCACCTCCTGTGGTTGG + Intergenic
1194369807 X:93058764-93058786 CTGAAAGCATTTCCCGGGGTTGG - Intergenic
1198190357 X:134298802-134298824 ATGTTGGCACTGCCAGGGGTGGG - Intergenic
1199003521 X:142669696-142669718 ATGATAGTACATACTGTGGTAGG + Intergenic
1200677996 Y:6174974-6174996 CTGAAAGCATTTCCCGGGGTTGG - Intergenic
1200729722 Y:6721266-6721288 ATGTTTGCACCTCCTGTGGTTGG + Intergenic
1201366758 Y:13215364-13215386 ATGATTGCTCTCTCTGGGGTAGG + Intergenic
1202021468 Y:20468985-20469007 ATAATAACACTTCCTGGGGTTGG - Intergenic