ID: 910192023

View in Genome Browser
Species Human (GRCh38)
Location 1:84604509-84604531
Sequence TGATAGCACTTCCTGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 2, 1: 0, 2: 3, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910192017_910192023 6 Left 910192017 1:84604480-84604502 CCAGATCTGAAAGACTATTTAAC No data
Right 910192023 1:84604509-84604531 TGATAGCACTTCCTGGGGTTGGG 0: 2
1: 0
2: 3
3: 12
4: 137
910192016_910192023 27 Left 910192016 1:84604459-84604481 CCGACAGGGGGATTTCGTGATCC No data
Right 910192023 1:84604509-84604531 TGATAGCACTTCCTGGGGTTGGG 0: 2
1: 0
2: 3
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910192023 Original CRISPR TGATAGCACTTCCTGGGGTT GGG Intergenic
901958498 1:12806543-12806565 TGACAGCACCTCCTAGAGTTTGG - Intergenic
903857158 1:26344192-26344214 TGAAGGCACCTCCTGGGGTCCGG + Exonic
905629062 1:39508782-39508804 TGATAAAACTTCCTGGGGTGTGG - Intronic
906455637 1:45994562-45994584 TGCTAGCACTCCCTGGTGCTAGG + Intronic
906523720 1:46481871-46481893 AGATAGCTCCTCCTGGGATTTGG + Intergenic
910192023 1:84604509-84604531 TGATAGCACTTCCTGGGGTTGGG + Intergenic
912403119 1:109412907-109412929 AGTTAGAACTTCCTGGGGCTTGG - Intronic
912537675 1:110387760-110387782 TGAGAGCCCTTCCTGGGGCTGGG - Intronic
916156132 1:161850519-161850541 TCATAGCACTTACTAGAGTTCGG + Intronic
917013050 1:170496863-170496885 TGTTAGTTCTTCCTGGAGTTTGG + Intergenic
920531242 1:206704134-206704156 TGATAGTTTTTCCTGGAGTTGGG + Intronic
922889385 1:229048426-229048448 AGAAAGCACGTCCTGGAGTTCGG + Intergenic
924803946 1:247347923-247347945 TGCTTGCACTTACTGGGGATGGG - Intergenic
1063396338 10:5691832-5691854 TGATACCAATGCCTGGGGTAGGG - Intronic
1066295416 10:34049858-34049880 TGAGAGAAGTTCCAGGGGTTCGG + Intergenic
1067576554 10:47412391-47412413 TGAATGGACTTCCTGGGGGTAGG - Intergenic
1069636421 10:69927799-69927821 TGATAGCAATTTCTGGGATTGGG - Intronic
1069712900 10:70501168-70501190 GGAGAGAACTTCCTGGGGTCAGG + Intronic
1071131684 10:82400953-82400975 TGCTATCTCTTCCTTGGGTTTGG + Intronic
1071777545 10:88806107-88806129 TGACAGCACTTCCAGTGGATGGG + Intronic
1073205708 10:101768269-101768291 TGAGAGCAATTCCTGGGGGAAGG - Intergenic
1074915410 10:117950652-117950674 TCAAAGGACTTCCTGGGCTTTGG - Intergenic
1075283146 10:121158550-121158572 AAATAGCTCCTCCTGGGGTTTGG + Intergenic
1078026466 11:7700407-7700429 TGGTGTGACTTCCTGGGGTTTGG - Exonic
1078558461 11:12350566-12350588 TAAAATTACTTCCTGGGGTTGGG - Intronic
1079016610 11:16874253-16874275 TCCTAGCACTTCCTGAGGCTGGG + Intronic
1083296625 11:61718705-61718727 TGATGTCACTTCCTGAGGGTGGG + Intronic
1087371404 11:97289623-97289645 TGATAGCACTTCCTCAGTTGTGG + Intergenic
1088992011 11:114961765-114961787 TGAGAGCACTGCCTGGGAATTGG - Intergenic
1090439884 11:126716631-126716653 TGATAGCTCCCCCTGGTGTTTGG - Intronic
1093680708 12:21998968-21998990 TGTTAACACTCTCTGGGGTTAGG + Intergenic
1094629433 12:32158406-32158428 TGATCTCAATTCCTGGGCTTGGG - Intronic
1095572540 12:43699671-43699693 TGACAGCCCATCCTGGGTTTTGG + Intergenic
1097457751 12:59820856-59820878 TGATAGCACTCCCAGGAGCTGGG - Intergenic
1097556820 12:61149002-61149024 TGGTCCCATTTCCTGGGGTTGGG - Intergenic
1106885878 13:34183683-34183705 TCATAGTACTTCTGGGGGTTGGG - Intergenic
1108294735 13:49002564-49002586 TGAAGGCAGTTCCTGGGGTTAGG - Intronic
1114473115 14:22977383-22977405 TGGGAGCAGTTCCTGGGGGTTGG - Intronic
1117261218 14:54035622-54035644 TGATACCTTTTCCTTGGGTTGGG + Intergenic
1119394975 14:74319534-74319556 TGGTACCATTTACTGGGGTTGGG + Intronic
1122138965 14:99650761-99650783 TCACAGCAGCTCCTGGGGTTTGG - Intronic
1126555524 15:49983594-49983616 AGACAGCAGGTCCTGGGGTTGGG - Intronic
1132296479 15:100738514-100738536 TGACAGCCCTTCCTGGGGAAAGG - Intergenic
1135589096 16:23692408-23692430 TGATAGAGCTGCCAGGGGTTTGG + Intronic
1135683787 16:24481231-24481253 TGATACCCATTCCTGGAGTTAGG - Intergenic
1137500969 16:49011337-49011359 TGGGAGCATTCCCTGGGGTTGGG + Intergenic
1138383683 16:56621328-56621350 TGATAGCAGGTCCTGCAGTTTGG + Intergenic
1141172824 16:81701919-81701941 TAATACCAATTTCTGGGGTTTGG - Intronic
1142381581 16:89735498-89735520 TGGCAGCACTTCCTTGGGTTTGG + Intronic
1143467141 17:7144950-7144972 TATCAGCACTTTCTGGGGTTGGG - Intergenic
1147743852 17:42683383-42683405 TGCTAGCACTGGCTGAGGTTGGG + Intronic
1147919437 17:43907093-43907115 TGTTAGCGCTTCCGGGGGTTGGG - Intronic
1148582651 17:48754270-48754292 TGAAAGCTCTTCCTGGGTTTGGG + Intergenic
1148984229 17:51607689-51607711 TGATAGAACATGCTGGGCTTTGG - Intergenic
1151263076 17:72931938-72931960 TGAGAGCAGGGCCTGGGGTTGGG - Intronic
1151475741 17:74343569-74343591 TGATAGCACTCCCATGGGGTGGG - Intronic
1159898310 18:74018335-74018357 TGATAGCACATCCTGGCAGTAGG + Intergenic
1161311240 19:3595417-3595439 TGCATGCCCTTCCTGGGGTTGGG + Intronic
1164762071 19:30735703-30735725 TGCCAGCCCTTCCTGAGGTTTGG - Intergenic
1166747007 19:45146217-45146239 TGGGAGCTCTTCCTGGGGTGGGG + Intronic
1167329250 19:48844448-48844470 TAAAAGCACTTCTTGGGGCTGGG - Intronic
1168207965 19:54866192-54866214 TGAGAGCACTTCATGGGATGGGG + Intronic
927441023 2:23117998-23118020 TGAGAACACTTGCTGGGGTCAGG + Intergenic
928108511 2:28488478-28488500 TGATGGCACTCCCTGGGGAGAGG - Intronic
928374236 2:30762078-30762100 TGACAGCACTTCCTGGCTATGGG - Intronic
928614220 2:33020302-33020324 GGAGAGCACTTTTTGGGGTTGGG + Intronic
929536741 2:42788548-42788570 TGATAGTCCTTCCTGGTGTTGGG + Exonic
930285534 2:49423030-49423052 TTCTAGGACTTCCTAGGGTTGGG + Intergenic
932197660 2:69798161-69798183 TGATAATACTTCCTGGGGTTGGG - Intronic
936475421 2:112835523-112835545 TTAGAGCCCTTCCTTGGGTTGGG + Intronic
941430261 2:165406249-165406271 TAACAGCACTCCCTGTGGTTAGG + Intergenic
943055322 2:182970679-182970701 TGAAAGCATTTCCTGAGATTTGG + Intronic
944111087 2:196131771-196131793 TGATAGCACTTCCTGGGGTTGGG - Intergenic
945205669 2:207329326-207329348 TGAGAGCATTTCCTGGGGAGTGG + Intergenic
1168975775 20:1964808-1964830 GCATAGCACCTCCCGGGGTTTGG + Intergenic
1172187839 20:33042341-33042363 TGTTGGCACCTCCTGGGGTCAGG - Intronic
1172427316 20:34863833-34863855 TGAGAACACTTCCTGGGGGGTGG + Intronic
1182059771 22:27388577-27388599 TGAAAGCACTTGGTGGGGTGAGG - Intergenic
1184508300 22:44917300-44917322 TGATGAGACTTACTGGGGTTCGG + Intronic
1185252889 22:49814692-49814714 TGAGAGCACCTCCTGGGCTCGGG - Intronic
949335766 3:2973582-2973604 TGATGACAATTCCTGGGATTAGG - Intronic
949948794 3:9212313-9212335 TGTGAGCACCTCTTGGGGTTGGG - Intronic
951775345 3:26304073-26304095 TGATAGCATTTCCTGGGAGCTGG + Intergenic
953184365 3:40624609-40624631 TGAAAGCAATCACTGGGGTTTGG + Intergenic
953869698 3:46615594-46615616 TGAAAGCCCTTCCTGGGATAAGG + Intronic
956637730 3:71382885-71382907 TGACGGCATCTCCTGGGGTTTGG + Intronic
960640961 3:119822580-119822602 TGAAAGTAATCCCTGGGGTTTGG - Intronic
963781855 3:149494358-149494380 TGACAGCACCTCCTGGTGGTAGG - Intronic
965547361 3:169930264-169930286 TGCTACCACTTCTTGGGGTAGGG - Intronic
966689150 3:182725676-182725698 CCATAGCACTTCCTGGGGTTGGG - Intergenic
970441779 4:16086207-16086229 TAACAGCACTACCTGGGGTTGGG - Intergenic
970762244 4:19504326-19504348 TGATTTCACTTCCTTGGGCTGGG + Intergenic
973815863 4:54618606-54618628 TAATATCAGTGCCTGGGGTTAGG - Intergenic
979593696 4:122509429-122509451 TGATTCCACTTCCAGGGATTTGG - Intergenic
985384805 4:189434305-189434327 GGACTGCACTGCCTGGGGTTTGG + Intergenic
985655239 5:1128297-1128319 TGAGAGCTCGTCCTGGGATTTGG - Intergenic
987317323 5:16735704-16735726 TAATAGCATTTTCTGGGTTTGGG - Intronic
991007255 5:61841524-61841546 TGATAGCATTTACAGGGATTTGG + Intergenic
992887017 5:81169186-81169208 TGATACCACTTCCTGAGATGGGG - Intronic
992954925 5:81898460-81898482 TGGTAGCAGTTCTTAGGGTTTGG + Intergenic
996173076 5:120320385-120320407 TGATAAAGCATCCTGGGGTTTGG - Intergenic
997611709 5:135220246-135220268 TTGTTGCACTTCCTGGGGTAGGG - Intronic
999713049 5:154335463-154335485 AGATATTACTCCCTGGGGTTAGG + Intronic
1000174681 5:158739843-158739865 TCACAGCACTTGCTGGGGTGGGG - Intronic
1000192002 5:158920333-158920355 TGATAGGAAGTCCAGGGGTTTGG - Intronic
1002849753 6:983289-983311 AGAAAGAACTTCCTGTGGTTAGG + Intergenic
1004431382 6:15547382-15547404 TGTCAGCATTACCTGGGGTTTGG - Intronic
1005080585 6:21952943-21952965 TTATCGCACTTCCTGAGGCTGGG - Intergenic
1005227626 6:23660736-23660758 TGATAGCCCTTGGTGGGGGTGGG - Intergenic
1007113931 6:39330093-39330115 TTATGGCACTACCTGGGATTGGG - Exonic
1007212825 6:40210701-40210723 TGATAGCACCTCCAGAAGTTGGG - Intergenic
1010320592 6:74504542-74504564 TGACTGCACTACCTGGTGTTGGG - Intergenic
1012028564 6:94029331-94029353 TCATTACACTGCCTGGGGTTGGG - Intergenic
1012885659 6:104843210-104843232 TGATAGCACTTACTGCTGTAAGG + Exonic
1014151039 6:118055615-118055637 TGATGGCAGATCCTGAGGTTAGG - Intronic
1014508288 6:122286562-122286584 TGATAAAACTTCCTAAGGTTTGG - Intergenic
1018740805 6:166727377-166727399 TGTTACCAGTTCCTGAGGTTTGG + Intronic
1022185906 7:27968601-27968623 AAATAGCACTTTCTGGTGTTTGG - Intronic
1023537023 7:41224577-41224599 TGTTAGCACTTCCTATGCTTAGG - Intergenic
1028846920 7:95491735-95491757 AGATAGCTTTACCTGGGGTTTGG + Intronic
1028920071 7:96301072-96301094 TCATAGAACTTCCTGGGTATTGG - Intronic
1029576761 7:101408466-101408488 TGACAGCACTTCCTGTAGCTGGG + Intronic
1029968744 7:104768375-104768397 TGATTGCACTCCCTGGAGATGGG - Intronic
1030830773 7:114218112-114218134 TGTTAGCACTTTCTGAGGTATGG - Intronic
1032605363 7:133344897-133344919 AGATATCACTTGCTGGGATTAGG + Intronic
1033943523 7:146684809-146684831 GAATAGCACTTTCTGGAGTTGGG - Intronic
1034434933 7:151059056-151059078 TGATGGCTCTGCCTAGGGTTCGG + Exonic
1035905556 8:3506187-3506209 TGACAGCTCGTCCTGGGGCTGGG - Intronic
1038280666 8:26161328-26161350 TCATAGCCTTTCCTGGGGGTGGG + Intergenic
1038344758 8:26722088-26722110 AAATGGAACTTCCTGGGGTTGGG + Intergenic
1039014547 8:33131299-33131321 TGACAGTATTTCTTGGGGTTGGG + Intergenic
1039359040 8:36855333-36855355 TGATAACACTCCCTGGGGATAGG + Intronic
1042701328 8:71618205-71618227 TGCTAGCACTGCCTGGGGGCAGG - Intergenic
1042898323 8:73695161-73695183 AAGTTGCACTTCCTGGGGTTAGG - Intronic
1042980167 8:74518166-74518188 TAGCTGCACTTCCTGGGGTTGGG + Intergenic
1047830366 8:128622801-128622823 GGATAGCAGTTCCTGGAGTGGGG - Intergenic
1048025030 8:130578208-130578230 TGATGGCAGACCCTGGGGTTTGG + Intergenic
1049423525 8:142527113-142527135 TGAGAGCACTCCCTGGGCTTGGG - Intronic
1049840162 8:144765860-144765882 TGGTTGCTCTTCCTGTGGTTTGG + Intergenic
1051101722 9:13529850-13529872 TGCCACCACTTCCTGGGGTGGGG - Intergenic
1056406156 9:86277162-86277184 TGAAAGCAATTCGTGGGGATTGG + Intronic
1056923856 9:90815534-90815556 TGACTGCACTTCCTGGAGTCAGG - Intronic
1057084500 9:92196637-92196659 GTATTGCACTGCCTGGGGTTAGG - Intergenic
1187199540 X:17121571-17121593 TAATAGCACATTCTGGGATTGGG - Intronic
1187572384 X:20518362-20518384 TGAGAGCCATTCCTGGGCTTTGG + Intergenic
1187580491 X:20602541-20602563 TGATACCACTTTCTTGGTTTAGG + Intergenic
1187663451 X:21575626-21575648 TCACAGCACTTCCTTGGGTCTGG - Intronic
1188007011 X:25022624-25022646 GGATAGCACTGCCCCGGGTTTGG - Intergenic
1189724619 X:43955651-43955673 TGGTGGCACCTCCTGGGTTTGGG - Intronic
1190021789 X:46885375-46885397 TGTTAAGACTTCCTGCGGTTTGG + Intergenic
1190878866 X:54478642-54478664 TAATAGCAGTTCCTTGGTTTGGG + Intronic
1198410537 X:136362693-136362715 TGTTTGCTCTTCTTGGGGTTGGG + Intronic
1199189001 X:144949196-144949218 TGATTGCACTGCCTGGAGTTAGG - Intergenic
1202021467 Y:20468984-20469006 TAATAACACTTCCTGGGGTTGGG - Intergenic