ID: 910194455

View in Genome Browser
Species Human (GRCh38)
Location 1:84625630-84625652
Sequence ACCCTCCCCCAGCCAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910194449_910194455 14 Left 910194449 1:84625593-84625615 CCCTAATATTCTGATTTGGGGTA No data
Right 910194455 1:84625630-84625652 ACCCTCCCCCAGCCAGGGTCAGG No data
910194451_910194455 -9 Left 910194451 1:84625616-84625638 CCTCATTTCTGACCACCCTCCCC No data
Right 910194455 1:84625630-84625652 ACCCTCCCCCAGCCAGGGTCAGG No data
910194450_910194455 13 Left 910194450 1:84625594-84625616 CCTAATATTCTGATTTGGGGTAC No data
Right 910194455 1:84625630-84625652 ACCCTCCCCCAGCCAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910194455 Original CRISPR ACCCTCCCCCAGCCAGGGTC AGG Intergenic
No off target data available for this crispr