ID: 910196212

View in Genome Browser
Species Human (GRCh38)
Location 1:84642268-84642290
Sequence CTGTAGCTACAGTTGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910196208_910196212 14 Left 910196208 1:84642231-84642253 CCTTTTGGACAAAATGAAGTATT 0: 1
1: 0
2: 1
3: 31
4: 344
Right 910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG 0: 1
1: 0
2: 1
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910196212 Original CRISPR CTGTAGCTACAGTTGGGACA CGG Intergenic
907639082 1:56167470-56167492 CTGAATCTACAGGTGGGAAAGGG + Intergenic
909151968 1:72018407-72018429 CTCTAGGTACAGTAGGGATAGGG - Intronic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
912690537 1:111801488-111801510 CTGTGGCTCCAGCTGGGACGTGG + Intronic
916824491 1:168430813-168430835 CTGTAGCTACAGCAGACACATGG + Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
1063577906 10:7278519-7278541 CTGGAGCTCCTGATGGGACAGGG + Intronic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1067961320 10:50853863-50853885 CTGTAGCCACATTTGGTTCATGG + Intronic
1068989215 10:63133648-63133670 CTGGAGCCGCAGTTGGGCCAGGG - Intronic
1070018863 10:72563858-72563880 TTTCAGTTACAGTTGGGACAAGG - Intronic
1076215967 10:128693608-128693630 CAGTAGCTGCAGCAGGGACAGGG - Intergenic
1076471886 10:130724799-130724821 AAGGAGCTACATTTGGGACAGGG + Intergenic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1084577285 11:69997538-69997560 CTGTGGCTGCCGTTGGGACGGGG - Intergenic
1089401208 11:118165816-118165838 GTGTGGCTGCAGATGGGACAGGG + Exonic
1089907550 11:122057816-122057838 CTCTAGCTACAGTTCTCACAGGG + Intergenic
1092236681 12:6814894-6814916 CTGGAGCTCCAGCTGAGACACGG - Exonic
1092502431 12:9061885-9061907 TCGTAGCTAGTGTTGGGACACGG + Intergenic
1094116291 12:26917947-26917969 CTGTAGTTTTAGTAGGGACAGGG - Intronic
1094552893 12:31469643-31469665 CTGGTGCTACGGTTTGGACATGG + Intronic
1097949152 12:65407427-65407449 CTTTACCTACAGCTGGAACAAGG - Intronic
1099392806 12:82101427-82101449 CTGTGGCTTCAGTTTGGAGAGGG - Intergenic
1100790321 12:98123252-98123274 CTGAAGCTACAGCTAGCACAGGG + Intergenic
1103709609 12:122902221-122902243 CTGTGGCTACCTCTGGGACATGG - Intergenic
1104429213 12:128703192-128703214 ATGTAGCTACACTTGTGTCATGG + Intronic
1104439537 12:128783547-128783569 CTGTAGCTCCATTTTAGACAGGG - Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1111094967 13:83501157-83501179 CTGTAGCTAAAGCAGGGAGATGG - Intergenic
1112339883 13:98544297-98544319 CTGTGTCTGCAGTTGGGCCACGG - Intronic
1113237983 13:108302784-108302806 CTGTTGCCACATTTGGGCCAAGG + Intronic
1117326190 14:54671196-54671218 TTTTAGCTGGAGTTGGGACATGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1120469804 14:84908507-84908529 ATGTAGCTTCATTTGGGAGAGGG - Intergenic
1121449092 14:93996468-93996490 CTGTGGCTGGAGTTGGGGCACGG - Intergenic
1123402945 15:20004523-20004545 CTGTGGCAGCTGTTGGGACAGGG + Intergenic
1123512285 15:21011177-21011199 CTGTGGCAGCTGTTGGGACAGGG + Intergenic
1123708357 15:22967131-22967153 CTCTAGCATCGGTTGGGACACGG + Intronic
1128155946 15:65392079-65392101 ATGTAGCTTCAGTGGGGACTGGG - Intronic
1129065537 15:72900993-72901015 CTGTAGGTACAGTTGTGATTAGG + Intergenic
1130562556 15:84970091-84970113 CTGTGATTACACTTGGGACAGGG + Intergenic
1133682549 16:8133492-8133514 CCGGAGCTGCAGTGGGGACAAGG - Intergenic
1135618320 16:23931261-23931283 CTGGAGCTAAAGGTGGGACCAGG + Intronic
1138538017 16:57670024-57670046 CTGTGGCTACAGGAGGGAAATGG + Intronic
1138729404 16:59178159-59178181 CTGTAGCACCCTTTGGGACATGG - Intergenic
1142463037 17:108763-108785 CTGTATTTTCAGTTGAGACAGGG + Intergenic
1148608795 17:48950074-48950096 CTGTAGTTTTAGTAGGGACAGGG + Intergenic
1149716442 17:58795062-58795084 TTGTATCTACAGTAGAGACAGGG + Intronic
1150949843 17:69790590-69790612 CTGTTGCTGAAGTTGGGAGAAGG + Intergenic
1151103846 17:71589021-71589043 ATGTAGCCACAGTGAGGACATGG - Intergenic
1154236786 18:12613475-12613497 CTGTAGCTACATTTGGCTAAAGG - Intronic
1157942026 18:51939675-51939697 CTGTGGCTATGGTTTGGACATGG + Intergenic
1160782148 19:882575-882597 CTGTGGCTGCATGTGGGACACGG + Intronic
1161793917 19:6375788-6375810 CTGTCCCTGCAGCTGGGACAGGG - Exonic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1165230217 19:34382034-34382056 CTGTAGCAACAGGTGGTCCATGG + Intronic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
927247173 2:20966630-20966652 CTGTCTCTACAGTTAAGACAGGG + Intergenic
929227358 2:39524605-39524627 CTGAATATACAGTTGAGACATGG + Intergenic
929577226 2:43059537-43059559 CTGAATCTACAGTTTGGGCAGGG + Intergenic
936938653 2:117860673-117860695 CTCTAGGTCTAGTTGGGACAAGG - Intergenic
941039911 2:160609618-160609640 CAGTAGCATTAGTTGGGACAGGG - Intergenic
941933992 2:170969173-170969195 CTGGAGCTACGGTAGTGACATGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
944111221 2:196132652-196132674 CTGAAGCTTTAGTTGGGACCAGG + Intergenic
944512208 2:200475921-200475943 GTCTATCTACAGTTGGGAAATGG - Intronic
1171125236 20:22596812-22596834 TTGCAGCCACAGTTGTGACAGGG + Intergenic
1171182278 20:23099511-23099533 CTGAATCTACAGTGGGGAGATGG - Intergenic
1171293182 20:23994229-23994251 CTGACTCTACAGGTGGGACAGGG - Intergenic
1172902727 20:38346692-38346714 CTCTGGGTACAGTGGGGACAGGG + Intronic
1172962478 20:38808246-38808268 CTGTTGCTACACTTGGGGCATGG - Intronic
1173258249 20:41410521-41410543 CTGCAGCTCCTCTTGGGACAGGG - Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174848421 20:53967159-53967181 CTGTAGCTACTATGTGGACAGGG - Intronic
1178292987 21:31385503-31385525 CTGTAGGGACGGTTGGGTCAAGG + Intronic
1178686893 21:34718972-34718994 CTGAAGGCAGAGTTGGGACAGGG - Intergenic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
955452767 3:59087672-59087694 TTGTAGCTACAAGTGGGACAGGG - Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
956823389 3:72973779-72973801 CTGGAGCTACAGTGGTGAAAAGG + Intronic
957512992 3:81214092-81214114 CTGTAGCTAAACTTGTGTCATGG + Intergenic
961085483 3:124063723-124063745 CTGTAGCTATATTTGGCAGATGG + Intergenic
961413419 3:126740228-126740250 CTGCAGCTGCAGGAGGGACAAGG - Intronic
961464055 3:127070857-127070879 CTGTGGCTACAGTTCGGAGAGGG + Intergenic
963807187 3:149735127-149735149 TTGTATCTTCAGTAGGGACAGGG + Intronic
968900626 4:3429970-3429992 CTGCAGCTGCAGCTGGGACCCGG + Intronic
969049278 4:4361148-4361170 CTGTAGTTATAGTAGAGACAGGG - Intronic
981914547 4:150019474-150019496 CTGTAGCTACAGGTGTTAGAGGG - Intergenic
982090377 4:151875331-151875353 CTGTAGCTGCACTGGGGCCAGGG + Intergenic
984131288 4:175878555-175878577 TTTTAGCCACAGCTGGGACAGGG + Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
995447191 5:112258302-112258324 CTGCAGCTACATTTGGGGTATGG - Intronic
1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG + Intronic
1002282019 5:178136577-178136599 CAGTGGCTACAGATGGGTCAAGG + Intronic
1002330752 5:178438915-178438937 CTTTTGGTGCAGTTGGGACAGGG - Intronic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1002564194 5:180100716-180100738 CTGTAGCCACAGTTCAGGCATGG - Intergenic
1004879421 6:19992438-19992460 CTGGAGCTAGAGGTGGGATAGGG + Intergenic
1007445571 6:41903011-41903033 GGGTAGCTACAGATGGGAAAAGG + Intergenic
1008678007 6:53842373-53842395 ATCTAGCTATATTTGGGACATGG - Intronic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1014020671 6:116585169-116585191 TTGTAGCTACATATGGGACTAGG - Intronic
1015886845 6:137926351-137926373 CTGTAACTACAGCTGGCACGGGG - Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1016882516 6:148924606-148924628 CTGGGGATACAATTGGGACAAGG - Intronic
1019161213 6:170068029-170068051 CTGTCTCTGCAGATGGGACAGGG + Intergenic
1020168565 7:5827115-5827137 TTGTAGTTTCAGTAGGGACAGGG + Intergenic
1029926159 7:104320307-104320329 CTGGAGCTGGAGTTGGGATAGGG - Intergenic
1035024427 7:155816756-155816778 CTGAAGCTACATTTGGGAGTTGG + Intergenic
1037885405 8:22593642-22593664 CTGATGCTACAGTGGGGACCAGG + Intronic
1037940522 8:22947720-22947742 CTGTAGCTCCAGAGGGGAAATGG + Intronic
1041398785 8:57419385-57419407 CTGGAGCTGGAGTTGGGCCATGG + Intergenic
1044844092 8:96363237-96363259 CTGGAGCTGGAGTTGTGACAAGG + Intergenic
1046584517 8:116134782-116134804 ATGAATCTACAGTTTGGACAGGG + Intergenic
1049160139 8:141092139-141092161 GTGTAGATACAGATGGGATAAGG + Intergenic
1061198438 9:129121823-129121845 GTGTAGCTGCAGTCAGGACAGGG + Intronic
1062395333 9:136350476-136350498 CTGCAGCTCCAGCTGGGCCAAGG + Intronic
1186166970 X:6837062-6837084 CTGAAACTACATTTGTGACATGG - Intergenic
1187277897 X:17832384-17832406 CTGTATGTACAGGTGCGACAGGG - Intronic
1187645865 X:21346469-21346491 CAGAAGCTACAGTTGGAACCCGG - Intergenic
1189729479 X:44004148-44004170 CTGTTGGGACATTTGGGACATGG - Intergenic
1189991762 X:46602504-46602526 CAGTAGCTTCAGGTGGGACCTGG - Intronic
1192170446 X:68851437-68851459 CTATAGCTACGGTGGGGACCAGG - Intergenic
1194196272 X:90896673-90896695 GTGTAGCTAGAGCTGAGACAAGG - Intergenic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1198989309 X:142492310-142492332 CTGTAGCTACAGGTGCCAGAAGG - Intergenic
1200542114 Y:4470866-4470888 GTGTAGCTAGAGCTGAGACAAGG - Intergenic
1200970507 Y:9147602-9147624 CTGTATCTGCATTTGAGACAAGG + Intergenic
1201761541 Y:17544974-17544996 CTGAAGCAACAGTAGAGACAAGG + Intergenic
1201840011 Y:18361016-18361038 CTGAAGCAACAGTAGAGACAAGG - Intergenic
1202140510 Y:21716717-21716739 CTGTATCTGCATTTGAGACAAGG - Intergenic
1202146355 Y:21787080-21787102 CTGTATCTGCATTTGAGACAAGG + Intergenic