ID: 910201027

View in Genome Browser
Species Human (GRCh38)
Location 1:84698850-84698872
Sequence CTAGCTAATCCCTTTGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910201025_910201027 -6 Left 910201025 1:84698833-84698855 CCAAAGATGATTCATTTCTAGCT No data
Right 910201027 1:84698850-84698872 CTAGCTAATCCCTTTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910201027 Original CRISPR CTAGCTAATCCCTTTGGATT TGG Intergenic
No off target data available for this crispr