ID: 910207239

View in Genome Browser
Species Human (GRCh38)
Location 1:84760058-84760080
Sequence TGCTGCCTTCTCGGGGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910207239_910207250 17 Left 910207239 1:84760058-84760080 CCCTAAGCCCCGAGAAGGCAGCA No data
Right 910207250 1:84760098-84760120 TATTCAGGCCGGGCAGTGCTGGG No data
910207239_910207244 2 Left 910207239 1:84760058-84760080 CCCTAAGCCCCGAGAAGGCAGCA No data
Right 910207244 1:84760083-84760105 ACCTTGCTCACCACTTATTCAGG No data
910207239_910207247 7 Left 910207239 1:84760058-84760080 CCCTAAGCCCCGAGAAGGCAGCA No data
Right 910207247 1:84760088-84760110 GCTCACCACTTATTCAGGCCGGG No data
910207239_910207249 16 Left 910207239 1:84760058-84760080 CCCTAAGCCCCGAGAAGGCAGCA No data
Right 910207249 1:84760097-84760119 TTATTCAGGCCGGGCAGTGCTGG No data
910207239_910207246 6 Left 910207239 1:84760058-84760080 CCCTAAGCCCCGAGAAGGCAGCA No data
Right 910207246 1:84760087-84760109 TGCTCACCACTTATTCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910207239 Original CRISPR TGCTGCCTTCTCGGGGCTTA GGG (reversed) Intergenic
No off target data available for this crispr