ID: 910208269

View in Genome Browser
Species Human (GRCh38)
Location 1:84769412-84769434
Sequence TTGGGCCAATGAAATATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910208269_910208274 5 Left 910208269 1:84769412-84769434 CCATTTATATTTCATTGGCCCAA No data
Right 910208274 1:84769440-84769462 GTCTATGGGAACTACATGCAAGG No data
910208269_910208275 6 Left 910208269 1:84769412-84769434 CCATTTATATTTCATTGGCCCAA No data
Right 910208275 1:84769441-84769463 TCTATGGGAACTACATGCAAGGG No data
910208269_910208276 13 Left 910208269 1:84769412-84769434 CCATTTATATTTCATTGGCCCAA No data
Right 910208276 1:84769448-84769470 GAACTACATGCAAGGGAAGCTGG No data
910208269_910208271 -9 Left 910208269 1:84769412-84769434 CCATTTATATTTCATTGGCCCAA No data
Right 910208271 1:84769426-84769448 TTGGCCCAAATTTAGTCTATGGG No data
910208269_910208270 -10 Left 910208269 1:84769412-84769434 CCATTTATATTTCATTGGCCCAA No data
Right 910208270 1:84769425-84769447 ATTGGCCCAAATTTAGTCTATGG No data
910208269_910208277 19 Left 910208269 1:84769412-84769434 CCATTTATATTTCATTGGCCCAA No data
Right 910208277 1:84769454-84769476 CATGCAAGGGAAGCTGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910208269 Original CRISPR TTGGGCCAATGAAATATAAA TGG (reversed) Intergenic
No off target data available for this crispr