ID: 910208314

View in Genome Browser
Species Human (GRCh38)
Location 1:84769825-84769847
Sequence AAAGATGCTAATGCAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910208309_910208314 15 Left 910208309 1:84769787-84769809 CCTCCAGGGTCGCCTGCTGTTAA No data
Right 910208314 1:84769825-84769847 AAAGATGCTAATGCAGAAAGAGG No data
910208311_910208314 3 Left 910208311 1:84769799-84769821 CCTGCTGTTAATCTGCCAACACC No data
Right 910208314 1:84769825-84769847 AAAGATGCTAATGCAGAAAGAGG No data
910208310_910208314 12 Left 910208310 1:84769790-84769812 CCAGGGTCGCCTGCTGTTAATCT No data
Right 910208314 1:84769825-84769847 AAAGATGCTAATGCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910208314 Original CRISPR AAAGATGCTAATGCAGAAAG AGG Intergenic