ID: 910208646

View in Genome Browser
Species Human (GRCh38)
Location 1:84772709-84772731
Sequence TTATGGCAAAGGCCTTAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910208641_910208646 14 Left 910208641 1:84772672-84772694 CCTAGAAAGATATGCTGTGTGAA No data
Right 910208646 1:84772709-84772731 TTATGGCAAAGGCCTTAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910208646 Original CRISPR TTATGGCAAAGGCCTTAGTG CGG Intergenic
No off target data available for this crispr