ID: 910208986

View in Genome Browser
Species Human (GRCh38)
Location 1:84774967-84774989
Sequence ATGAAGGAGAGGAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910208986_910208999 30 Left 910208986 1:84774967-84774989 CCATCCATCTTCCTCTCCTTCAT No data
Right 910208999 1:84775020-84775042 CTGCAGGGAGCGCTCTCACCAGG No data
910208986_910208995 15 Left 910208986 1:84774967-84774989 CCATCCATCTTCCTCTCCTTCAT No data
Right 910208995 1:84775005-84775027 GCCTGCCCTGAGGGTCTGCAGGG No data
910208986_910208992 5 Left 910208986 1:84774967-84774989 CCATCCATCTTCCTCTCCTTCAT No data
Right 910208992 1:84774995-84775017 AGGCAGTGTGGCCTGCCCTGAGG No data
910208986_910208993 6 Left 910208986 1:84774967-84774989 CCATCCATCTTCCTCTCCTTCAT No data
Right 910208993 1:84774996-84775018 GGCAGTGTGGCCTGCCCTGAGGG No data
910208986_910208991 -7 Left 910208986 1:84774967-84774989 CCATCCATCTTCCTCTCCTTCAT No data
Right 910208991 1:84774983-84775005 CCTTCATCTGAGAGGCAGTGTGG No data
910208986_910208994 14 Left 910208986 1:84774967-84774989 CCATCCATCTTCCTCTCCTTCAT No data
Right 910208994 1:84775004-84775026 GGCCTGCCCTGAGGGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910208986 Original CRISPR ATGAAGGAGAGGAAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr