ID: 910211260

View in Genome Browser
Species Human (GRCh38)
Location 1:84795841-84795863
Sequence TCCTCTCCGTGCTCACAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910211256_910211260 20 Left 910211256 1:84795798-84795820 CCTGGCTGTCAGCTGTTGGCTGC No data
Right 910211260 1:84795841-84795863 TCCTCTCCGTGCTCACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910211260 Original CRISPR TCCTCTCCGTGCTCACAATA TGG Intergenic
No off target data available for this crispr