ID: 910214185

View in Genome Browser
Species Human (GRCh38)
Location 1:84825721-84825743
Sequence CTCAGCGTCATCATCAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910214185_910214190 10 Left 910214185 1:84825721-84825743 CCAGGTTTGATGATGACGCTGAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 910214190 1:84825754-84825776 CAAACAGAGAAAGGCCCAGGAGG 0: 1
1: 0
2: 4
3: 29
4: 286
910214185_910214192 15 Left 910214185 1:84825721-84825743 CCAGGTTTGATGATGACGCTGAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 910214192 1:84825759-84825781 AGAGAAAGGCCCAGGAGGCCGGG 0: 1
1: 2
2: 7
3: 80
4: 646
910214185_910214189 7 Left 910214185 1:84825721-84825743 CCAGGTTTGATGATGACGCTGAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 910214189 1:84825751-84825773 TCTCAAACAGAGAAAGGCCCAGG No data
910214185_910214191 14 Left 910214185 1:84825721-84825743 CCAGGTTTGATGATGACGCTGAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG No data
910214185_910214187 1 Left 910214185 1:84825721-84825743 CCAGGTTTGATGATGACGCTGAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 910214187 1:84825745-84825767 TTCCTATCTCAAACAGAGAAAGG 0: 1
1: 0
2: 0
3: 31
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910214185 Original CRISPR CTCAGCGTCATCATCAAACC TGG (reversed) Intronic
903542614 1:24105460-24105482 CTCACCGTCATCCTCAACCCTGG + Intronic
904679290 1:32217577-32217599 CTCATTCTCATTATCAAACCAGG - Intronic
910214185 1:84825721-84825743 CTCAGCGTCATCATCAAACCTGG - Intronic
912734877 1:112141827-112141849 ATCAGCCTCATGATCAAAGCAGG + Intergenic
916423598 1:164659938-164659960 CTCAGAGTCAACAGGAAACCTGG - Intronic
918965506 1:191342436-191342458 CTCAGTATCCTCAGCAAACCTGG - Intergenic
924111845 1:240707710-240707732 GTCATTGTTATCATCAAACCAGG + Intergenic
1063463455 10:6228808-6228830 CTCAGCGTCATAGTCACGCCCGG + Intronic
1066367467 10:34791385-34791407 GGCAGCGTCATCACCAAGCCCGG + Intronic
1067213528 10:44281553-44281575 CTCAGCCTCATGGTCAAAGCAGG + Intergenic
1067373755 10:45708769-45708791 TTCATCTTCATCATCAAACAGGG + Intergenic
1067379929 10:45763464-45763486 TTCATCTTCATCATCAAACAGGG - Exonic
1067881584 10:50050535-50050557 TTCATCTTCATCATCAAACAGGG + Intergenic
1067887628 10:50104118-50104140 TTCATCTTCATCATCAAACAGGG - Exonic
1080202547 11:29689814-29689836 CTCTGGGTCATTATCAAACTTGG - Intergenic
1083274131 11:61587426-61587448 CTCAGCCTCAGCCTCAGACCTGG - Intergenic
1083423123 11:62567388-62567410 CTCAGACTCACCATCAAACTGGG + Exonic
1084721298 11:70907190-70907212 CTCAGGGTCTTCCTCTAACCTGG - Intronic
1087200311 11:95338349-95338371 CTCAGCATGTTTATCAAACCTGG + Intergenic
1098960429 12:76734441-76734463 CTCAGCAAAATCAGCAAACCAGG - Intergenic
1101556603 12:105815878-105815900 TTCAGCCTTATCATCAAACAAGG + Intergenic
1104357871 12:128104236-128104258 CTCAGCCTCATCATCTAAAATGG - Intergenic
1108147137 13:47490067-47490089 CTCAGACTCATCATCAATTCTGG - Intergenic
1121928758 14:97952857-97952879 CTCAGCACCATCATCAAAGTTGG + Intronic
1133352519 16:5111094-5111116 CTCAGTGTCATCATCACATGAGG - Intergenic
1136328449 16:29551286-29551308 ATCAGTGTCATCACCAAAGCTGG - Intergenic
1136443134 16:30291300-30291322 ATCAGTGTCATCACCAAAGCTGG - Intergenic
1138475534 16:57268807-57268829 CTCAGGGTGATCATGACACCTGG - Intronic
1142360294 16:89622990-89623012 CTCAGCGTCTTCCTCACTCCCGG - Intronic
1143328926 17:6120086-6120108 CACAGCGTCCTCATCCCACCAGG + Intronic
1145809242 17:27754887-27754909 CACAGCGTTCTCATCAAAACGGG - Intergenic
1145907193 17:28522999-28523021 TTCAGCGTCATCATCTAACTGGG - Intronic
1152710951 17:81870418-81870440 CTCAGCGTCATCTTTCAAACAGG + Intronic
1158883907 18:61807237-61807259 CTCAGCCTCATGATTAAACTAGG + Intergenic
1159965696 18:74593882-74593904 TACATAGTCATCATCAAACCAGG + Intergenic
1163244460 19:16084492-16084514 CTCAACGTCAGCATCCAGCCAGG - Intronic
1165710039 19:38004515-38004537 GTCAGTGTCATCCTCAAACGTGG + Intronic
1167733473 19:51276296-51276318 CACAGGGTCATCAGAAAACCAGG + Intergenic
925580870 2:5409234-5409256 CACAACGTCATCAACAACCCTGG + Intergenic
928435038 2:31249411-31249433 ATCAGCGTCATCGACACACCAGG + Exonic
933076848 2:77939480-77939502 CTCAGTGTCATAATAAAATCAGG + Intergenic
933731063 2:85456567-85456589 CTCAGCTGCATCATCAGTCCTGG + Intergenic
940150869 2:150598885-150598907 CTCAGCCTGATTATCAGACCAGG - Intergenic
944098907 2:196000837-196000859 ATCAGCCTCATGATGAAACCTGG + Exonic
945677664 2:212875632-212875654 CTCAGAGTTCTCATAAAACCAGG + Intergenic
946171658 2:217899275-217899297 CTCAGAGTCAAACTCAAACCGGG - Intronic
946453667 2:219802822-219802844 CTCAATGTCATCATTAAACTGGG - Intergenic
1170202948 20:13764738-13764760 CTCATTGTCATCATCACACTGGG + Intronic
1170656253 20:18289794-18289816 CTCAGCGTCAACAGCATATCAGG + Intronic
1175467250 20:59197732-59197754 CTAAGCCTCATCATCAGCCCTGG + Intronic
1175877588 20:62237775-62237797 CTCAGTTTCATCTGCAAACCAGG - Intronic
1177851135 21:26350022-26350044 CTCAGTGTCATTTTCAGACCCGG + Intergenic
1179780744 21:43699285-43699307 CTCAGAGACATCCTCACACCAGG - Intergenic
1182029337 22:27145308-27145330 CTCAGCGTCCTGAGCAAACCGGG + Intergenic
950156794 3:10727075-10727097 CTCAGAGTCTGCATCAGACCAGG + Intergenic
952277158 3:31887992-31888014 CTCAGGCTCATCACCAAGCCAGG + Intronic
952461824 3:33535246-33535268 GTCAGCATCATCATCAAACATGG + Exonic
962190023 3:133300578-133300600 CTCTGCGTCCTCATTAAACCTGG - Intronic
966218771 3:177529999-177530021 CTCAGCTTCATTATAAAACTAGG - Intergenic
967589122 3:191251733-191251755 ATCAGCATCATCTTCAAAACAGG + Intronic
967704935 3:192639203-192639225 CTCAGCGTCATTAATAATCCGGG + Intronic
968968713 4:3782390-3782412 CTCTGCGCCACCTTCAAACCTGG + Intergenic
969070591 4:4535123-4535145 CTCAAAGTGATCATCAAACTTGG - Intronic
970452606 4:16185802-16185824 CTCAAGGACATCATCAAGCCAGG + Intronic
983422282 4:167534225-167534247 CTCAGTGTAAACATCAAATCAGG - Intergenic
985036961 4:185850125-185850147 CTCATAGGCATCTTCAAACCAGG - Intronic
986365570 5:7026656-7026678 CTCAACGTCATTAGCAAACTGGG + Intergenic
987269680 5:16293746-16293768 CTCAGCATCATTATCCAAACTGG + Intergenic
989375164 5:40753556-40753578 CTCATAGTCATCTTCAAACATGG - Intronic
1000714288 5:164621773-164621795 CTCTGCCTCATTATCAATCCTGG + Intergenic
1014701020 6:124688096-124688118 CTCAGTGTTATCATCAAATTTGG - Intronic
1014871571 6:126602845-126602867 CTCAGAGAGATCAACAAACCTGG + Intergenic
1016410403 6:143776876-143776898 CTCAGCTGCATGATCAAAGCTGG + Intronic
1019661322 7:2225584-2225606 CTCAGTGACGGCATCAAACCAGG + Intronic
1021181844 7:17516150-17516172 TTTGGTGTCATCATCAAACCTGG - Intergenic
1035721030 8:1791997-1792019 CTCAGCGTCATCAGCCATCAGGG - Intergenic
1040641607 8:49340849-49340871 CTCTTCATCATCATCAAGCCAGG - Intergenic
1049000654 8:139823724-139823746 CTCAGCGTCAGCCCCATACCTGG - Intronic
1049458617 8:142709431-142709453 CTCAGTGGCATCATAAAAGCAGG - Intergenic
1061123232 9:128657000-128657022 CTCAGCGCCATCTTTGAACCTGG - Intergenic
1062368362 9:136222948-136222970 CCTGGCGTCACCATCAAACCTGG + Intronic
1186130531 X:6460979-6461001 CCCGGCTTCATCACCAAACCAGG - Intergenic
1195209451 X:102638763-102638785 ATCTATGTCATCATCAAACCAGG + Intergenic
1195858949 X:109359876-109359898 CTCAGCGGCATCATTAATCAAGG + Intergenic
1201613049 Y:15864695-15864717 CCCTGCTTCATCATAAAACCAGG - Intergenic