ID: 910214191 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:84825758-84825780 |
| Sequence | CAGAGAAAGGCCCAGGAGGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910214185_910214191 | 14 | Left | 910214185 | 1:84825721-84825743 | CCAGGTTTGATGATGACGCTGAG | 0: 1 1: 0 2: 0 3: 5 4: 79 |
||
| Right | 910214191 | 1:84825758-84825780 | CAGAGAAAGGCCCAGGAGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910214191 | Original CRISPR | CAGAGAAAGGCCCAGGAGGC CGG | Intronic | ||
| No off target data available for this crispr | |||||