ID: 910214191

View in Genome Browser
Species Human (GRCh38)
Location 1:84825758-84825780
Sequence CAGAGAAAGGCCCAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910214185_910214191 14 Left 910214185 1:84825721-84825743 CCAGGTTTGATGATGACGCTGAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910214191 Original CRISPR CAGAGAAAGGCCCAGGAGGC CGG Intronic
No off target data available for this crispr