ID: 910216341

View in Genome Browser
Species Human (GRCh38)
Location 1:84848308-84848330
Sequence CCCCTGCTGGGCCCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910216333_910216341 2 Left 910216333 1:84848283-84848305 CCTTCAACTTAAGAACCCCAGAA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG No data
910216332_910216341 11 Left 910216332 1:84848274-84848296 CCAAGAAAGCCTTCAACTTAAGA 0: 1
1: 0
2: 0
3: 20
4: 169
Right 910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG No data
910216331_910216341 14 Left 910216331 1:84848271-84848293 CCGCCAAGAAAGCCTTCAACTTA No data
Right 910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG No data
910216330_910216341 15 Left 910216330 1:84848270-84848292 CCCGCCAAGAAAGCCTTCAACTT 0: 1
1: 0
2: 1
3: 18
4: 145
Right 910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG No data
910216329_910216341 29 Left 910216329 1:84848256-84848278 CCTTAAATGCAGGTCCCGCCAAG No data
Right 910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910216341 Original CRISPR CCCCTGCTGGGCCCTGAGGC TGG Intronic
No off target data available for this crispr