ID: 910216931

View in Genome Browser
Species Human (GRCh38)
Location 1:84852545-84852567
Sequence ACGTGCACACCTGGATGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 415}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910216931_910216937 22 Left 910216931 1:84852545-84852567 CCAGGACATCCAGGTGTGCACGT 0: 1
1: 0
2: 1
3: 26
4: 415
Right 910216937 1:84852590-84852612 TGGGATCTCCTGAAAGGCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 239
910216931_910216938 26 Left 910216931 1:84852545-84852567 CCAGGACATCCAGGTGTGCACGT 0: 1
1: 0
2: 1
3: 26
4: 415
Right 910216938 1:84852594-84852616 ATCTCCTGAAAGGCTGAGGATGG No data
910216931_910216936 16 Left 910216931 1:84852545-84852567 CCAGGACATCCAGGTGTGCACGT 0: 1
1: 0
2: 1
3: 26
4: 415
Right 910216936 1:84852584-84852606 AGAGATTGGGATCTCCTGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 225
910216931_910216934 2 Left 910216931 1:84852545-84852567 CCAGGACATCCAGGTGTGCACGT 0: 1
1: 0
2: 1
3: 26
4: 415
Right 910216934 1:84852570-84852592 CAGCAGCTGGAAACAGAGATTGG 0: 1
1: 0
2: 3
3: 60
4: 412
910216931_910216935 3 Left 910216931 1:84852545-84852567 CCAGGACATCCAGGTGTGCACGT 0: 1
1: 0
2: 1
3: 26
4: 415
Right 910216935 1:84852571-84852593 AGCAGCTGGAAACAGAGATTGGG 0: 1
1: 0
2: 2
3: 42
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910216931 Original CRISPR ACGTGCACACCTGGATGTCC TGG (reversed) Intronic
900440650 1:2653442-2653464 ACGTGCACACCTGGGGGTGCAGG - Intronic
900441228 1:2656450-2656472 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900442230 1:2661628-2661650 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900443123 1:2666244-2666266 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900444017 1:2670860-2670882 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900444921 1:2675516-2675538 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900445629 1:2679250-2679272 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900446764 1:2685072-2685094 ACGTGCACACCTGGGGGTGCAGG - Intronic
900447078 1:2686676-2686698 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900447362 1:2688081-2688103 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900447536 1:2688846-2688868 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900448078 1:2691617-2691639 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900448257 1:2692498-2692520 ACGTGCACACCTGGGGGTGCAGG - Intronic
900448574 1:2694102-2694124 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900448990 1:2696190-2696212 ACGTGCACACCTGGGGGTGCAGG - Intronic
900449015 1:2696311-2696333 ACGTGCACACCTGGGGGTGCAGG - Intronic
900449189 1:2697116-2697138 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900450388 1:2746626-2746648 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900450931 1:2749397-2749419 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900451536 1:2752445-2752467 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900451731 1:2753450-2753472 ACGTGCACACCTGGGGGTGCAGG - Intronic
900452045 1:2755054-2755076 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900452457 1:2757141-2757163 ACGTGCACACCTGGGGGTGCAGG - Intronic
900452482 1:2757262-2757284 ACTTGCACACCTGGGGGTGCAGG - Intronic
900452657 1:2758067-2758089 ACGTGCGCACCTGGGGGTGCAGG - Intronic
900575675 1:3381266-3381288 ACATGCACGCCTGGATGGCGAGG + Intronic
900730835 1:4258550-4258572 ATGGAAACACCTGGATGTCCAGG + Intergenic
900954893 1:5880796-5880818 ACTTGCAAACCTGAGTGTCCTGG + Intronic
902115334 1:14116524-14116546 ATGGAAACACCTGGATGTCCAGG + Intergenic
905095285 1:35464992-35465014 ATGGAAACACCTGGATGTCCAGG + Intronic
905998053 1:42399262-42399284 CCTTGTACACCAGGATGTCCAGG + Intronic
906369601 1:45241422-45241444 ATGGAAACACCTGGATGTCCAGG - Intronic
906872851 1:49503303-49503325 ATGCAAACACCTGGATGTCCAGG + Intronic
906894688 1:49758234-49758256 ATGGAAACACCTGGATGTCCAGG + Intronic
907259413 1:53206236-53206258 ATGGAAACACCTGGATGTCCAGG + Intronic
907687182 1:56623495-56623517 AGGGAAACACCTGGATGTCCGGG + Intronic
907710207 1:56873738-56873760 ACGTGCAGCCCTGTATTTCCTGG - Intronic
908392966 1:63699985-63700007 ACAAGCATCCCTGGATGTCCTGG - Intergenic
908487649 1:64610905-64610927 ATGGAAACACCTGGATGTCCAGG - Intronic
908871713 1:68620512-68620534 ATGGAAACACCTGGATGTCCAGG - Intergenic
909710841 1:78647463-78647485 ATGGAAACACCTGGATGTCCAGG - Intergenic
909834024 1:80231131-80231153 ATGGAAACACCTGGATGTCCAGG - Intergenic
910216931 1:84852545-84852567 ACGTGCACACCTGGATGTCCTGG - Intronic
910330144 1:86063713-86063735 ACTTGTTCACCTGGAAGTCCTGG + Exonic
911848428 1:102783867-102783889 ATGGAAACACCTGGATGTCCAGG - Intergenic
912084033 1:105976970-105976992 ATGTAAACACCTGGATGTACGGG + Intergenic
916910551 1:169341386-169341408 ATGAAAACACCTGGATGTCCAGG + Intronic
917245560 1:172996990-172997012 ATGGAAACACCTGGATGTCCAGG + Intergenic
919044222 1:192430825-192430847 ATGGAAACACCTGGATGTCCAGG + Intergenic
919179221 1:194059581-194059603 ATGAAAACACCTGGATGTCCAGG - Intergenic
919273750 1:195385239-195385261 ATGGAAACACCTGGATGTCCAGG + Intergenic
920804256 1:209218324-209218346 TTGTCCACACCTGGCTGTCCTGG - Intergenic
920826462 1:209427965-209427987 AAGTGCACACCTGGAGGGCAAGG - Intergenic
921062606 1:211598346-211598368 GTGTGCACACCAGGATCTCCTGG - Intergenic
921758329 1:218883921-218883943 ATGGAAACACCTGGATGTCCAGG - Intergenic
922530473 1:226341374-226341396 ATGGAAACACCTGGATGTCCAGG + Intergenic
923876846 1:238058711-238058733 ATGGAAACACCTGGATGTCCAGG - Intergenic
923890927 1:238214364-238214386 ATGGAAACACCTGGATGTCCAGG - Intergenic
1062920524 10:1275373-1275395 ATGTGCACACCTGGGTGCCATGG - Intronic
1063976605 10:11422853-11422875 ACCTTCACACCTGTAGGTCCTGG + Intergenic
1066627854 10:37427642-37427664 AAGTGCAGACATGGATGTGCAGG + Intergenic
1067015748 10:42755332-42755354 CCGATCCCACCTGGATGTCCCGG - Intergenic
1068160231 10:53253699-53253721 ATGGAAACACCTGGATGTCCAGG + Intergenic
1068284202 10:54913445-54913467 ATGAAAACACCTGGATGTCCAGG + Intronic
1070724182 10:78777272-78777294 CCGTGCATACTGGGATGTCCAGG - Intergenic
1071799884 10:89047326-89047348 ACATGCACACCTGGAGTTTCTGG + Intergenic
1072035784 10:91561675-91561697 ATGGAAACACCTGGATGTCCGGG - Intergenic
1072488015 10:95874733-95874755 ATGGAAACACCTGGATGTCCAGG - Exonic
1074223634 10:111462296-111462318 ATGAAAACACCTGGATGTCCAGG + Intergenic
1075643846 10:124084814-124084836 AAATCCCCACCTGGATGTCCAGG + Intronic
1076689752 10:132216878-132216900 ATGGAAACACCTGGATGTCCAGG + Intronic
1077193389 11:1265744-1265766 ACGGAAACACCTGAATGTCCAGG - Intergenic
1077228012 11:1446799-1446821 AGGAGCACACCAGGAGGTCCAGG + Intronic
1077350424 11:2090682-2090704 ATGCGCACACTTGTATGTCCAGG + Intergenic
1077578986 11:3404906-3404928 GGGTGCAGACCTGGATGTGCTGG - Intergenic
1078085588 11:8231490-8231512 ACGGGTCCACATGGATGTCCAGG - Intronic
1078496711 11:11824855-11824877 ATGGAAACACCTGGATGTCCAGG - Intergenic
1078712941 11:13812891-13812913 ATGGAAACACCTGGATGTCCAGG - Intergenic
1078826976 11:14938866-14938888 ATGGAAACACCTGGATGTCCAGG - Intronic
1079521168 11:21328421-21328443 ATGGAAACACCTGGATGTCCAGG + Intronic
1079759436 11:24310428-24310450 ATGGAAACACCTGGATGTCCAGG + Intergenic
1081801102 11:45859865-45859887 ACGTGCACAGCTGTGTGACCTGG - Intronic
1084836392 11:71804566-71804588 GGGTGCAGACCTGGATGTGCTGG + Intergenic
1085000341 11:73027982-73028004 ATGGAAACACCTGGATGTCCAGG + Intronic
1085236513 11:75019701-75019723 ATGAAAACACCTGGATGTCCAGG + Intergenic
1085418392 11:76335182-76335204 ATGAAAACACCTGGATGTCCAGG + Intergenic
1085866766 11:80303726-80303748 ATGGGAACACCTGGATGCCCAGG + Intergenic
1087385512 11:97464049-97464071 ATGAAAACACCTGGATGTCCAGG + Intergenic
1091552898 12:1550324-1550346 ATGGAAACACCTGGATGTCCAGG + Intronic
1092406917 12:8227787-8227809 GGGTGCAGACCTGGATGTGCTGG - Intergenic
1093207070 12:16263894-16263916 ATGGAAACACCTGGATGTCCAGG + Intronic
1093581343 12:20787033-20787055 ATGGAAACACCTGGATGTCCAGG + Intergenic
1093624247 12:21327243-21327265 ATGGAAACACCTGGATGTCCAGG + Intronic
1093973946 12:25400840-25400862 ATGGAAACACCTGGATGTCCAGG + Intergenic
1095216698 12:39557840-39557862 ATGGAAACACCTGGATGTCCAGG + Intronic
1095928810 12:47605841-47605863 ATGGAAACACCTGGATGTCCAGG - Intergenic
1096566094 12:52480502-52480524 ATGGAAACACCTGGATGTCCAGG + Intergenic
1097136875 12:56864485-56864507 ATGGAAACACCTGGATGTCCAGG + Intergenic
1097480418 12:60117093-60117115 ATGGAAACACCTGGATGTCCAGG - Intergenic
1097526276 12:60740105-60740127 ATGGAAACACCTGGATGTCCAGG - Intergenic
1097571261 12:61335114-61335136 ACATGGAAACCTGAATGTCCAGG - Intergenic
1098578458 12:72070976-72070998 ATGGAAACACCTGGATGTCCAGG - Intronic
1099526776 12:83726471-83726493 ATGGCAACACCTGGATGTCCAGG + Intergenic
1099929096 12:89052939-89052961 ACAGAAACACCTGGATGTCCAGG - Intergenic
1100787674 12:98096063-98096085 ATGGCAACACCTGGATGTCCAGG + Intergenic
1101117817 12:101549229-101549251 ACGGAAACACCTGGATGTCCAGG - Intergenic
1101883774 12:108644015-108644037 ACGGGCAACCCTTGATGTCCAGG - Intergenic
1101943813 12:109120754-109120776 ACGTGCACACCTGGAGCTGGAGG + Intronic
1106553195 13:30788874-30788896 ACATGCACACCTGGATGTTAAGG - Intergenic
1106614728 13:31316038-31316060 ACGGAAATACCTGGATGTCCAGG + Intronic
1108885678 13:55178486-55178508 ATGGAAACACCTGGATGTCCAGG + Intergenic
1108910974 13:55551061-55551083 ATGGAAACACCTGGATGTCCAGG + Intergenic
1109035241 13:57250060-57250082 ATGTGCACACATGGATGTAGAGG + Intergenic
1109416863 13:62051732-62051754 ATGGAAACACCTGGATGTCCAGG + Intergenic
1110511447 13:76355902-76355924 ATGGAAACACCTGGATGTCCAGG + Intergenic
1111318065 13:86586650-86586672 ATGAAAACACCTGGATGTCCAGG + Intergenic
1111716646 13:91887089-91887111 ATGGAAACACCTGGATGTCCAGG - Intronic
1112769705 13:102782014-102782036 ACGGAAACACCTGGATGTTCAGG + Intergenic
1113341771 13:109432750-109432772 ATGGAAACACCTGGATGTCCAGG - Intergenic
1114687561 14:24548379-24548401 ATGGAAACACCTGGATGTCCAGG - Intergenic
1116098896 14:40408373-40408395 ATGGAAACACCTGGATGTCCAGG - Intergenic
1117085491 14:52196448-52196470 ATGGAAACACCTGGATGTCCAGG + Intergenic
1117427908 14:55620485-55620507 ATGGAAACACCTGGATGTCCAGG - Intronic
1118524273 14:66622087-66622109 ACGTAAATACCTGGATGTCCAGG - Intronic
1118533431 14:66732052-66732074 ATGGAAACACCTGGATGTCCAGG + Intronic
1119963109 14:78882149-78882171 ATGGAAACACCTGGATGTCCAGG + Intronic
1120377582 14:83729541-83729563 ATGCAAACACCTGGATGTCCAGG - Intergenic
1120405051 14:84084080-84084102 ATGGAAACACCTGGATGTCCAGG - Intergenic
1120485877 14:85112762-85112784 AGGGAAACACCTGGATGTCCAGG - Intergenic
1120696374 14:87649846-87649868 ACGGGAACACCTGGATGTCCAGG + Intergenic
1120971911 14:90214717-90214739 ACGGAAACACCTGTATGTCCAGG - Intergenic
1121396305 14:93626297-93626319 ACCTACACACCTGGACTTCCTGG + Intronic
1121499057 14:94419193-94419215 ATGGAAACACCTGGATGTCCAGG + Intergenic
1122765501 14:104066680-104066702 ATGGGAACACCTGGATGTCCAGG - Intergenic
1124226262 15:27897582-27897604 ATGGGAACACCTGGATGTCCAGG + Intronic
1124634577 15:31356834-31356856 ACGTGCACACCTCCAAGCCCTGG - Intronic
1124885337 15:33680181-33680203 TAGTGCTCAGCTGGATGTCCTGG + Intronic
1124962360 15:34408615-34408637 CTGTGCACCCCTGGCTGTCCTGG + Intronic
1125225357 15:37389600-37389622 ATGGAAACACCTGGATGTCCAGG - Intergenic
1126190541 15:45873635-45873657 ATGCAAACACCTGGATGTCCAGG - Intergenic
1126648007 15:50894409-50894431 ATGGAAACACCTGGATGTCCAGG + Intergenic
1126648024 15:50894564-50894586 ATGGAAACACCTGGATGTCCAGG + Intergenic
1128782991 15:70375215-70375237 CAGTGCACACCAGGATGTCAGGG - Intergenic
1132717913 16:1301304-1301326 GAGTGCAGACCTGGCTGTCCCGG - Intergenic
1132884196 16:2175345-2175367 GCGTGCACACCGGGTTGTCATGG - Exonic
1133347588 16:5080998-5081020 GGGTGCAGACCTGGATGTGCTGG - Exonic
1135653859 16:24230448-24230470 ACGTGCACACCTGTAATCCCAGG + Intergenic
1136990401 16:35148216-35148238 CTGTGCACACCTGGATCTCATGG - Intergenic
1137555241 16:49466221-49466243 ATGCGCACCCCTGGATGTCTCGG + Intergenic
1138859972 16:60744247-60744269 ATGGAAACACCTGGATGTCCAGG - Intergenic
1139373966 16:66485398-66485420 CCATGCCCACCTGCATGTCCAGG + Intronic
1139546325 16:67651502-67651524 ACCCTCTCACCTGGATGTCCTGG - Exonic
1141272769 16:82556054-82556076 AGGGAAACACCTGGATGTCCAGG - Intergenic
1141975101 16:87510495-87510517 ATGAAAACACCTGGATGTCCAGG - Intergenic
1143136728 17:4716446-4716468 CCGTGAAGACCTGGATGTGCTGG + Exonic
1144285464 17:13770014-13770036 ATGGAAACACCTGGATGTCCAGG - Intergenic
1146391784 17:32429759-32429781 ATGGAAACACCTGGATGTCCAGG + Intergenic
1147591653 17:41687824-41687846 ATGTAAACACCTGGATTTCCTGG + Intergenic
1148390527 17:47268913-47268935 ATGGAAACACCTGGATGTCCAGG - Intronic
1149053678 17:52336863-52336885 ATGTGCATATCTGGATTTCCGGG - Intergenic
1149572138 17:57679546-57679568 CAGAGCATACCTGGATGTCCAGG + Exonic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151155381 17:72120757-72120779 ACTTACACACTTGGAAGTCCCGG + Intergenic
1152291794 17:79444054-79444076 AAATGCACACCTGTATGTTCAGG + Intronic
1152529510 17:80908991-80909013 CCGGGCACACCTGGAGTTCCTGG - Intronic
1153580687 18:6570727-6570749 ATCTGCACAGCTGGAAGTCCAGG + Intronic
1154431606 18:14312988-14313010 ACGGGAACACCTGGGTGTTCAGG + Intergenic
1154434295 18:14332290-14332312 ACGGGAACACCTGGGTGTTCAGG + Intergenic
1154506576 18:15046101-15046123 ATGGAAACACCTGGATGTCCAGG - Intergenic
1155716673 18:28952550-28952572 ATGGAAACACCTGGATGTCCAGG - Intergenic
1156122667 18:33863869-33863891 ATGGGAACACCTGGATATCCAGG - Intronic
1156322351 18:36038485-36038507 ATGGAAACACCTGGATGTCCAGG + Intronic
1156475778 18:37404513-37404535 AAGTGCACAGTTGGATGCCCAGG + Intronic
1157409400 18:47450892-47450914 ACGTGAAGACCTGTGTGTCCAGG - Intergenic
1158101529 18:53834916-53834938 ATGGAAACACCTGGATGTCCAGG + Intergenic
1159071101 18:63624834-63624856 ATGGAAACACCTGGATGTCCAGG - Intergenic
1159731636 18:72034628-72034650 ATGGAAACACCTGGATGTCCAGG - Intergenic
1164807338 19:31127216-31127238 CGGTGCACACAAGGATGTCCGGG - Intergenic
1164938487 19:32232959-32232981 ACGTGCCCACCACCATGTCCTGG + Intergenic
1165708764 19:37994905-37994927 AGGTGCTCACCTGGAACTCCAGG + Intronic
1168496215 19:56853906-56853928 ACGGAAACACCTGAATGTCCAGG + Intergenic
1168655372 19:58123572-58123594 ATGGGAACACCTGGACGTCCAGG - Intergenic
925035953 2:685984-686006 ATGGAAACACCTGGATGTCCAGG + Intergenic
925291941 2:2753884-2753906 ATATCAACACCTGGATGTCCAGG + Intergenic
926206499 2:10837688-10837710 ACTTGCACACCAGGCTGCCCAGG - Intronic
926280588 2:11442626-11442648 ATGGAAACACCTGGATGTCCAGG - Intergenic
927170864 2:20368161-20368183 ATGGAAACACCTGGATGTCCAGG - Intergenic
928749907 2:34459127-34459149 ATGGAAACACCTGGATGTCCAGG + Intergenic
929227059 2:39521778-39521800 ACGGAAAGACCTGGATGTCCAGG - Intergenic
930404860 2:50942222-50942244 ATGGAAACACCTGGATGTCCAGG + Intronic
930544132 2:52745755-52745777 ATGGAAACACCTGGATGTCCAGG + Intergenic
931949829 2:67350080-67350102 ATGGAGACACCTGGATGTCCAGG - Intergenic
933092466 2:78137980-78138002 ACGGAAACGCCTGGATGTCCAGG + Intergenic
935324951 2:101927554-101927576 ATGGAAACACCTGGATGTCCAGG + Intergenic
936811449 2:116407734-116407756 ATGGAAACACCTGGATGTCCAGG + Intergenic
936984605 2:118297066-118297088 ATGGAAACACCTGGATGTCCAGG - Intergenic
937115063 2:119398995-119399017 CAGTGCTCGCCTGGATGTCCAGG + Intergenic
937800616 2:126076996-126077018 ATGGCAACACCTGGATGTCCAGG + Intergenic
937889486 2:126926421-126926443 ATGAAAACACCTGGATGTCCAGG + Intergenic
938307743 2:130266444-130266466 ACCTTGACACCTGGAGGTCCTGG - Intergenic
938320412 2:130358863-130358885 CCGAGCAGGCCTGGATGTCCTGG - Exonic
938447595 2:131390397-131390419 ACCTTGACACCTGGAGGTCCTGG + Intergenic
938957037 2:136308334-136308356 ACGGGCACACCAGTGTGTCCAGG + Intergenic
939037394 2:137149257-137149279 ATGAGAATACCTGGATGTCCAGG + Intronic
939605899 2:144254494-144254516 ATGGAAACACCTGGATGTCCAGG + Intronic
940691344 2:156924193-156924215 ACGGAAACACCTGAATGTCCAGG + Intergenic
941431856 2:165422988-165423010 ATGAAAACACCTGGATGTCCAGG - Intergenic
941967283 2:171312613-171312635 ATGGACACACCTGGATGTCCAGG + Intergenic
942727529 2:179026490-179026512 ATGGAAACACCTGGATGTCCAGG + Intronic
943092941 2:183395783-183395805 ATGGAAACACCTGGATGTCCAGG + Intergenic
943511253 2:188830402-188830424 ACGGAAACACCTGGATGTCCAGG + Intergenic
943781228 2:191826063-191826085 AAGTGCCCTCCTTGATGTCCCGG + Intergenic
943788173 2:191901522-191901544 ATGGAAACACCTGGATGTCCAGG + Intergenic
944250211 2:197573972-197573994 AAGGAAACACCTGGATGTCCAGG + Intronic
944272207 2:197796351-197796373 ATGTAAACCCCTGGATGTCCAGG - Intergenic
944371185 2:198985495-198985517 ATGAAAACACCTGGATGTCCAGG - Intergenic
944458169 2:199916987-199917009 ATGAAAACACCTGGATGTCCAGG - Intronic
945623424 2:212170809-212170831 ATGGAAACACCTGGATGTCCAGG + Intronic
947144326 2:227050975-227050997 ACCTGGTCACCTGGAAGTCCTGG + Exonic
948177356 2:235954609-235954631 ACGTGCAAACATGGCTGTCGAGG - Intronic
1169643022 20:7776556-7776578 ATGTAAACACCTGGATGTCCAGG + Intergenic
1169676344 20:8159152-8159174 ATGGAAACACCTGGATGTCCAGG - Intronic
1173412764 20:42828806-42828828 ATGGAAACACCTGGATGTCCAGG + Intronic
1174148406 20:48468613-48468635 ACCTGTACACCTGCATGGCCTGG + Intergenic
1176164170 20:63664258-63664280 AGGTCCTCACCTGGATTTCCAGG + Intronic
1176791288 21:13323006-13323028 ATGGAAACACCTGGATGTCCAGG + Intergenic
1177367202 21:20153581-20153603 ATGGAAACACCTGGATGTCCAGG - Intergenic
1177476778 21:21633818-21633840 ACGGTAACACCTGGATATCCAGG - Intergenic
1177477656 21:21644852-21644874 ATGGAAACACCTGGATGTCCAGG + Intergenic
1177496139 21:21894725-21894747 ATGGAAACACCTGGATGTCCAGG - Intergenic
1177570268 21:22877594-22877616 TGGTAAACACCTGGATGTCCAGG - Intergenic
1177606040 21:23378994-23379016 ATGGAAACACCTGGATGTCCAGG + Intergenic
1180595537 22:16970606-16970628 ATGTGCACAACTGAATGCCCAGG + Intronic
1182330163 22:29545983-29546005 ACGGAAACACCTGGATGCCCAGG - Intronic
1183004503 22:34890073-34890095 ATGAAAACACCTGGATGTCCAGG + Intergenic
1183590452 22:38776626-38776648 ACGTGGACACCTGGCCTTCCAGG - Intronic
1184141714 22:42581627-42581649 CCGTCCACACCTGCTTGTCCAGG - Intergenic
1184552452 22:45211768-45211790 ATGTGCAAATCTGGATGTGCTGG - Intronic
949692973 3:6662094-6662116 ATGGAAACACCTGGATGTCCAGG - Intergenic
950990660 3:17434304-17434326 ATGGAAACACCTGGATGTCCAGG - Intronic
951132904 3:19069188-19069210 ATGAAAACACCTGGATGTCCAGG + Intergenic
952220062 3:31315911-31315933 ATGGAAACACCTGGATGTCCAGG + Intergenic
952569915 3:34701813-34701835 ATGGAAACACCTGGATGTCCAGG - Intergenic
953456548 3:43046978-43047000 ATGGAAACACCTGGATGTCCAGG + Intronic
953541895 3:43827659-43827681 ACAACCACACCTGGAAGTCCTGG - Intergenic
953607159 3:44419567-44419589 CCATGCACAAGTGGATGTCCTGG + Intergenic
953624825 3:44562100-44562122 ATGGAAACACCTGGATGTCCAGG - Intronic
953835434 3:46339064-46339086 ATGAAAACACCTGGATGTCCAGG - Intergenic
954133403 3:48571099-48571121 ACCTTCACACCTGGAGGGCCAGG + Exonic
956336930 3:68175144-68175166 ATGGAAACACCTGGATGTCCAGG + Intronic
956938590 3:74131846-74131868 ACGGAAACACCTGGATGCCCAGG - Intergenic
957051974 3:75418223-75418245 GGGTGCAGACCTGGATGTGCTGG - Intergenic
958154090 3:89730737-89730759 ATGGAAACACCTGGATGTCCAGG + Intergenic
958646574 3:96882279-96882301 ATGGAAACACCTGGATGTCCAGG - Intronic
958685411 3:97386822-97386844 ATGGAAACACCTGGATGTCCAGG - Intronic
958688052 3:97425319-97425341 ATGGAAACACCTGGATGTCCAGG - Intronic
959161030 3:102724725-102724747 ACGGAAACACCTGGATGCCCAGG + Intergenic
959846607 3:111040595-111040617 ATGGAAACACCTGGATGTCCAGG + Intergenic
960362878 3:116735419-116735441 ATGAAAACACCTGGATGTCCAGG + Intronic
960499517 3:118419472-118419494 ATGGAAACACCTGGATGTCCAGG - Intergenic
960858006 3:122122978-122123000 ATGGGAACACCTGGATGTCCAGG + Intergenic
962057347 3:131886370-131886392 ACGGAAACACCTGGATGCCCAGG + Intronic
964375447 3:156044514-156044536 GGGTGCAGACCTGGATGTGCTGG + Intronic
964853377 3:161119124-161119146 ACGGAAACTCCTGGATGTCCAGG + Intronic
964934009 3:162059550-162059572 ATGGGAACACCTGGATGTCCAGG - Intergenic
965395041 3:168152849-168152871 ATGAAAACACCTGGATGTCCAGG + Intergenic
967633897 3:191778508-191778530 ATGTAAACACCTGGATGCCCAGG + Intergenic
968175927 3:196549490-196549512 ATGGACACACCTGGATGTCCAGG + Intergenic
968578605 4:1379333-1379355 CCCTGCCCACCTGGATGCCCAGG - Intronic
968695839 4:2026027-2026049 ACAGAAACACCTGGATGTCCAGG - Intronic
968994776 4:3938598-3938620 GGGTGCAGACCTGGATGTGCTGG - Intergenic
969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG + Intronic
969759225 4:9170196-9170218 GGGTGCAGACCTGGATGTGCTGG + Intergenic
969993056 4:11283887-11283909 ATGGAAACACCTGGATGTCCAGG - Intergenic
970678263 4:18477291-18477313 ACGGAAACACCTGGATGTTCAGG - Intergenic
972847157 4:43004281-43004303 ATGGAAACACCTGGATGTCCAGG + Intronic
974171366 4:58270803-58270825 ATGGAAACACCTGGATGTCCAGG + Intergenic
974666544 4:64969504-64969526 ATGGGAACACCTGGACGTCCAGG - Intergenic
974733606 4:65900245-65900267 ATGGAAACACCTGGATGTCCAGG + Intergenic
974872501 4:67660576-67660598 ATGAAAACACCTGGATGTCCAGG + Intronic
976141981 4:82002413-82002435 ATGAAAACACCTGGATGTCCAGG + Intronic
976482206 4:85557618-85557640 ATGTGTTCACCTGGATGTTCCGG + Intronic
976988050 4:91327231-91327253 ATGGAAACACCTGGATGTCCAGG - Intronic
977942889 4:102877710-102877732 ATGGAAACACCTGGATGTCCAGG - Intronic
977977744 4:103286812-103286834 ATGGAAACACCTGGATGTCCAGG + Intergenic
978921024 4:114183295-114183317 ATGGAAACACCTGGATGTCCAGG + Intergenic
979116080 4:116826416-116826438 ATGGAAACACCTGGATGTCCTGG - Intergenic
979146171 4:117251476-117251498 ATGGAAACACCTGGATGTCCAGG + Intergenic
979764395 4:124446756-124446778 ATGGAAACACCTGGATGTCCAGG - Intergenic
979867663 4:125776573-125776595 ACAGGAACACTTGGATGTCCAGG + Intergenic
979951331 4:126897266-126897288 ATGGAAACACCTGGATGTCCAGG - Intergenic
979966895 4:127086686-127086708 ATGGAAACACCTGGATGTCCAGG + Intergenic
980293104 4:130870645-130870667 ATGGAAACACCTGGATGTCCAGG + Intergenic
980425129 4:132618291-132618313 ATGAAAACACCTGGATGTCCAGG - Intergenic
980707611 4:136520028-136520050 ATGGAAACACCTGGATGTCCAGG - Intergenic
982019661 4:151190694-151190716 ATGGAAACACCTGGATGTCCAGG + Intronic
982432414 4:155338148-155338170 ATGGAAACACCTGGATGTCCAGG + Intergenic
983006400 4:162490475-162490497 ATGGAAACACCTGGATGTCCAGG + Intergenic
984512265 4:180693353-180693375 ATGGAAACACCTGGATGTCCAGG - Intergenic
984517003 4:180753067-180753089 ATGGAAACACCTGGATGTCCAGG - Intergenic
984785603 4:183564840-183564862 ACGTGCACACCACCATGCCCAGG + Intergenic
984839946 4:184059079-184059101 ACGTGCTCCCCTGCATTTCCTGG + Intergenic
985624690 5:979047-979069 TCGTGGACACCTGGCTGTCGGGG - Intergenic
986315263 5:6582908-6582930 TCCTGCACACCTGTATGGCCTGG + Intergenic
986582341 5:9278861-9278883 ATGTAAACACCTTGATGTCCAGG + Intronic
986900200 5:12421832-12421854 ATGAAAACACCTGGATGTCCAGG + Intergenic
987225960 5:15841894-15841916 ATGGAAACACCTGGATGTCCAGG + Intronic
987509308 5:18815247-18815269 ATGGAAACACCTGGATGTCCAGG - Intergenic
987610683 5:20198992-20199014 AGGAAAACACCTGGATGTCCAGG + Intronic
987642361 5:20628819-20628841 ATGGGAACACCTGGATGCCCAGG - Intergenic
987694185 5:21307472-21307494 ATGTGTCCACCTGGATGTTCCGG - Intergenic
987723085 5:21663532-21663554 ATGGAAACACCTGGATGTCCAGG - Intergenic
987794370 5:22607925-22607947 ATGGGAACACCTGGAAGTCCAGG + Intronic
987967339 5:24893484-24893506 ATGAAAACACCTGGATGTCCAGG - Intergenic
988142644 5:27263710-27263732 ATGGAAACACCTGGATGTCCAGG + Intergenic
988319135 5:29669972-29669994 ATGGAAACACCTGGATGTCCAGG + Intergenic
988886415 5:35563265-35563287 ATGGAAACACCTGGATGTCCAGG + Intergenic
988928559 5:36013621-36013643 ATGAATACACCTGGATGTCCAGG + Intergenic
989056785 5:37373555-37373577 AGGTCCACACCTGGCTGCCCAGG - Intergenic
989726854 5:44597331-44597353 ATGGAAACACCTGGATGTCCAGG - Intergenic
989746840 5:44839449-44839471 ATGGAAACACCTGGATGTCCAGG + Intergenic
990572427 5:57092851-57092873 AGGTGCACACCACCATGTCCGGG - Intergenic
991746062 5:69741998-69742020 ATGTGTCCACCTGGATGTTCCGG + Intergenic
991751643 5:69813243-69813265 ATGTGTCCACCTGGATGTTCCGG - Intergenic
991797664 5:70321956-70321978 ATGTGTCCACCTGGATGTTCCGG + Intergenic
991825440 5:70617312-70617334 ATGTGTCCACCTGGATGTTCCGG + Intergenic
991830930 5:70688136-70688158 ATGTGTCCACCTGGATGTTCCGG - Intergenic
991890006 5:71321277-71321299 ATGTGTCCACCTGGATGTTCCGG + Intergenic
992310953 5:75498669-75498691 ATGGAAACACCTGGATGTCCAGG + Intronic
992777948 5:80104730-80104752 TCGGGCCCACCTGGATGTGCTGG + Intergenic
992954209 5:81891035-81891057 ATGGAAACACCTGGATGTCCAGG + Intergenic
993036977 5:82769368-82769390 ATGGACACACCTGGCTGTCCAGG + Intergenic
993409353 5:87554693-87554715 ATGGAAACACCTGGATGTCCAGG - Intergenic
993711562 5:91230345-91230367 ATGGAAACACCTGGATGTCCAGG - Intergenic
994019292 5:95004756-95004778 ATGGAAACACCTGGATGTCCAGG + Intronic
996802582 5:127420160-127420182 ACGTGTGCACCTGGATGGCGCGG + Exonic
998813932 5:145993482-145993504 ATGGAAACACCTGGATGTCCAGG - Intronic
999999483 5:157124081-157124103 TGGTGCACACCTGTATTTCCAGG - Intronic
1000270652 5:159680249-159680271 ATGTAAGCACCTGGATGTCCAGG + Intergenic
1001836449 5:174836712-174836734 ATGGAAACACCTGGATGTCCAGG + Intergenic
1005218042 6:23554611-23554633 ATGGAAACACCTGGATGTCCAGG - Intergenic
1006313546 6:33277635-33277657 CCGTGCACACCAGGATGAGCAGG - Exonic
1007566338 6:42853718-42853740 ACCTGCACAGCTGGATGGCCAGG - Exonic
1010549266 6:77201218-77201240 ACAGAAACACCTGGATGTCCAGG + Intergenic
1010735854 6:79443107-79443129 ATGGAAACACCTGGATGTCCAGG - Intergenic
1011933055 6:92738046-92738068 ATGGGAATACCTGGATGTCCAGG + Intergenic
1012195451 6:96335764-96335786 ATGGAAACACCTGGATGTCCAGG + Intergenic
1012202527 6:96424144-96424166 ATGTAAACACCTGGATGTCCAGG - Intergenic
1012281056 6:97328694-97328716 ATGGAAACACCTGGATGTCCAGG + Intergenic
1012349441 6:98232720-98232742 ATGGAAACACCTGGATGTCCAGG - Intergenic
1012617359 6:101293383-101293405 CCAGGAACACCTGGATGTCCAGG - Intergenic
1013146979 6:107403558-107403580 ATGGAAACACCTGGATGTCCAGG - Intronic
1014374769 6:120659183-120659205 ATGGAAACACCTGGATGTCCAGG - Intergenic
1014407471 6:121069172-121069194 ATGAAAACACCTGGATGTCCAGG + Intergenic
1016106594 6:140171226-140171248 ATGTATACACCTGAATGTCCAGG - Intergenic
1016284960 6:142462717-142462739 ATGGAAACACCTGGATGTCCAGG - Intergenic
1018742256 6:166738927-166738949 ACATGCACACCTGGATATCTAGG - Intronic
1019564161 7:1671345-1671367 ACGTGCACACCTGGCTCGGCCGG - Intergenic
1021519688 7:21526880-21526902 ATGGAAACACCTGGATGTCCAGG + Intergenic
1022027178 7:26459503-26459525 CCCTGCACACCTGGATTTCCTGG + Intergenic
1022492887 7:30834218-30834240 ATGGAAACACCTGGATGTCCAGG - Intronic
1022549716 7:31227413-31227435 ATGGAAACACCTGGATGTCCAGG + Intergenic
1022909143 7:34883154-34883176 ATGGAAACACCTGGATGTCCAGG - Intergenic
1024721184 7:52139028-52139050 ATGGAAACACCTGGATGTCCAGG - Intergenic
1024801664 7:53087049-53087071 ACCTGCACACCTGGCTGCACAGG - Intergenic
1027597749 7:80196730-80196752 ACAGACACACCTGAATGTCCTGG + Intronic
1028023703 7:85809150-85809172 ATGGAAACACCTGGATGTCCAGG + Intergenic
1028133629 7:87204941-87204963 ACAGAAACACCTGGATGTCCAGG - Intronic
1029178760 7:98684302-98684324 AGGTGCACACCAGCATGTCCAGG + Intergenic
1030754665 7:113273047-113273069 ATGGAAACACCTGGATGTCCAGG - Intergenic
1031290503 7:119928483-119928505 ATGGAAACACCTGGATGTCCAGG + Intergenic
1031608245 7:123794711-123794733 ACGGAAACACCTGGATGTCCAGG + Intergenic
1031626822 7:124001569-124001591 ATGTGAAAGCCTGGATGTCCAGG - Intergenic
1033072848 7:138220714-138220736 ACGGAAACGCCTGGATGTCCAGG + Intergenic
1033885043 7:145934163-145934185 ATGGAAACACCTGGATGTCCAGG + Intergenic
1034212157 7:149373291-149373313 ATGGAAACACCTGGATGTCCAGG - Intergenic
1034573056 7:151972789-151972811 ATGGAAACACCTGGATGTCCAGG + Intronic
1034718356 7:153264388-153264410 ATGGCAACACCTGGATGTCCAGG - Intergenic
1034751046 7:153569289-153569311 ATGTAAACACCTGGATGTCAAGG - Intergenic
1036154289 8:6327417-6327439 ACGTACACCCTTGGCTGTCCTGG - Intergenic
1036381366 8:8238227-8238249 GGGTGCAGACCTGGATGTGCTGG + Intergenic
1036518497 8:9468467-9468489 ATGGAAACACCTGGATGTCCAGG + Intergenic
1036981485 8:13474348-13474370 ATGGAAACACCTGGATGTCCAGG + Intronic
1038280444 8:26159280-26159302 ATGGAAACACCTGGATGTCCAGG - Intergenic
1038764012 8:30410858-30410880 ACGTGCAGTCCTGGCTTTCCAGG - Intronic
1039309233 8:36297767-36297789 ATGGAAACACCTGGATGTCCAGG + Intergenic
1039497670 8:37993194-37993216 ATGGAAACACCTGGATGTCCAGG - Intergenic
1039757975 8:40543325-40543347 TCGTCCAGACCTGGATGCCCTGG - Intronic
1041438016 8:57863217-57863239 ATGGAAACACCTGGATGTCCAGG + Intergenic
1041479780 8:58307194-58307216 ATGGAAACACCTGGATGTCCAGG - Intergenic
1042057983 8:64786822-64786844 ATGTAAACACCTGGATGTCCAGG - Intronic
1043092996 8:75928417-75928439 ATGGAAACACCTGGATGTCCAGG - Intergenic
1043275289 8:78385213-78385235 ATGAGAACGCCTGGATGTCCAGG + Intergenic
1043297467 8:78683324-78683346 ATGGAAACACCTGGATGTCCAGG - Intronic
1043336251 8:79180319-79180341 ATGGAAACACCTGGATGTCCAGG - Intergenic
1044295135 8:90518822-90518844 ACGGGAATGCCTGGATGTCCAGG + Intergenic
1045993708 8:108339222-108339244 ATGGAAACACCTGGATGTCCAGG - Intronic
1046170387 8:110497967-110497989 ATGAAAACACCTGGATGTCCAGG + Intergenic
1046358368 8:113117423-113117445 ATGGCAACACCTGGATGTCCAGG + Intronic
1046668843 8:117035716-117035738 ATGGAAACACCTGGATGTCCAGG - Intronic
1048213448 8:132476167-132476189 ATGGAAACACCTGGATGTCCAGG + Intronic
1048269578 8:133017854-133017876 AGGTACCCACCTGGATGGCCTGG - Exonic
1048658583 8:136571444-136571466 ATGGAAACACCTGGATGTCCAGG + Intergenic
1048700010 8:137078099-137078121 ATGGAAACACCTGGATGTCCAGG + Intergenic
1048726154 8:137387363-137387385 ATGGAAACACCTGGATGTCCAGG - Intergenic
1048895769 8:138990835-138990857 ATGGAAACACCTGGATGTCCAGG - Intergenic
1050508498 9:6370969-6370991 ACGAAAACACCTGGATGTCCAGG + Intergenic
1050849310 9:10264093-10264115 ATGGGAACACCTGGAAGTCCAGG + Intronic
1051089077 9:13385251-13385273 AAGGGAACACCTGGATGTCTAGG + Intergenic
1052080813 9:24203505-24203527 ATGGAAACACCTGGATGTCCAGG + Intergenic
1052087954 9:24291067-24291089 ATGGAAACACCTGGATGTCCAGG - Intergenic
1052382737 9:27789253-27789275 ATGGCAACACCTGGATGTCCAGG + Intergenic
1053625626 9:39867863-39867885 ATGGAAACACCTGGATGTCCAGG + Intergenic
1054218262 9:62382838-62382860 ATGGAAACACCTGGATGTCCAGG - Intergenic
1055701287 9:78948217-78948239 ATGGAAACACCTGGATGTCCAGG + Intergenic
1056434042 9:86557995-86558017 ACGTGTGCACATGGATGTGCTGG + Intergenic
1056549055 9:87636231-87636253 GCTTGGACTCCTGGATGTCCTGG + Intronic
1056595163 9:88002037-88002059 ATGGAAACACCTGGATGTCCAGG + Intergenic
1057710316 9:97435490-97435512 AGGTGCACACCACCATGTCCAGG - Intronic
1058401553 9:104625322-104625344 ATGGAAACACCTGGATGTCCAGG + Intergenic
1059069492 9:111120455-111120477 ATGGAAACACCTGGATGTCCAGG - Intergenic
1062318816 9:135980645-135980667 ACCTGCCCACCTGGCTGTGCCGG + Intergenic
1062393172 9:136342141-136342163 ATGTGCCCCCCAGGATGTCCAGG + Intronic
1186620432 X:11235141-11235163 ATGGAAACACCTGGATGTCCAGG - Intronic
1187615773 X:20991736-20991758 ACGGAAACACCTCGATGTCCAGG - Intergenic
1187619132 X:21030703-21030725 ATGGAAACACCTGGATGTCCAGG - Intergenic
1187734400 X:22289627-22289649 ATGGAAACACCTGGATGTCCAGG + Intergenic
1187972630 X:24674073-24674095 ACTTGCACAGTTGGATGTGCTGG + Intergenic
1188781811 X:34295053-34295075 ATGGAAACACCTGGATGTCCAGG + Intergenic
1188925935 X:36043913-36043935 ATGGAAACACCTGGATGTCCAGG - Intronic
1188926528 X:36051052-36051074 ATGTAATCACCTGGATGTCCAGG + Intronic
1188961883 X:36502376-36502398 ATGGAAACACCTGGATGTCCAGG - Intergenic
1189176554 X:38963426-38963448 ATGGAAACACCTGGATGTCCAGG - Intergenic
1190140683 X:47841000-47841022 ACGGGCACACCTGGCTATCGGGG - Intronic
1193459720 X:81775848-81775870 ATGGAAACACCTGGATGTCCAGG - Intergenic
1194560324 X:95411886-95411908 ATGGAAACACCTGGATGTCCAGG + Intergenic
1197366765 X:125573002-125573024 ACAGAAACACCTGGATGTCCAGG - Intergenic
1197451875 X:126629224-126629246 ATGGAAACACCTGGATGTCCAGG - Intergenic
1199309589 X:146307514-146307536 ATGGAAACACCTGGATGTCCAGG + Intergenic
1199823203 X:151471340-151471362 ATGGAAACACCTGGATGTCCAGG - Intergenic
1199928429 X:152494119-152494141 ATGGAAACACCTGGATGTCCAGG + Intergenic
1200356950 X:155562148-155562170 ATGGAAACACCTGGATGTCCAGG - Intronic
1200578415 Y:4917231-4917253 ATGGAAACACCTGGATGTCCAGG - Intergenic