ID: 910219424

View in Genome Browser
Species Human (GRCh38)
Location 1:84875550-84875572
Sequence ATCTGGCAAGGGCCATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 7, 2: 32, 3: 61, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910219424_910219428 -4 Left 910219424 1:84875550-84875572 CCATGGGATGGCCCTTGCCAGAT 0: 2
1: 7
2: 32
3: 61
4: 198
Right 910219428 1:84875569-84875591 AGATGCCAGTGCCAAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910219424 Original CRISPR ATCTGGCAAGGGCCATCCCA TGG (reversed) Intronic