ID: 910220013

View in Genome Browser
Species Human (GRCh38)
Location 1:84880553-84880575
Sequence GGTCCTCTGCAGCATGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910220013_910220016 3 Left 910220013 1:84880553-84880575 CCAAGTCCATGCTGCAGAGGACC No data
Right 910220016 1:84880579-84880601 GAGTACACACTACTGAAGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910220013 Original CRISPR GGTCCTCTGCAGCATGGACT TGG (reversed) Intronic
No off target data available for this crispr