ID: 910222869 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:84906253-84906275 |
Sequence | CAATGTATGAGACTCCTAGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910222869_910222873 | 23 | Left | 910222869 | 1:84906253-84906275 | CCAACTAGGAGTCTCATACATTG | No data | ||
Right | 910222873 | 1:84906299-84906321 | AACCATTTTGAAAACCTATTTGG | No data | ||||
910222869_910222872 | -3 | Left | 910222869 | 1:84906253-84906275 | CCAACTAGGAGTCTCATACATTG | No data | ||
Right | 910222872 | 1:84906273-84906295 | TTGTCAATGGGAGTAAAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910222869 | Original CRISPR | CAATGTATGAGACTCCTAGT TGG (reversed) | Intergenic | ||