ID: 910222869

View in Genome Browser
Species Human (GRCh38)
Location 1:84906253-84906275
Sequence CAATGTATGAGACTCCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910222869_910222873 23 Left 910222869 1:84906253-84906275 CCAACTAGGAGTCTCATACATTG No data
Right 910222873 1:84906299-84906321 AACCATTTTGAAAACCTATTTGG No data
910222869_910222872 -3 Left 910222869 1:84906253-84906275 CCAACTAGGAGTCTCATACATTG No data
Right 910222872 1:84906273-84906295 TTGTCAATGGGAGTAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910222869 Original CRISPR CAATGTATGAGACTCCTAGT TGG (reversed) Intergenic