ID: 910222872

View in Genome Browser
Species Human (GRCh38)
Location 1:84906273-84906295
Sequence TTGTCAATGGGAGTAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910222869_910222872 -3 Left 910222869 1:84906253-84906275 CCAACTAGGAGTCTCATACATTG No data
Right 910222872 1:84906273-84906295 TTGTCAATGGGAGTAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910222872 Original CRISPR TTGTCAATGGGAGTAAAAAA TGG Intergenic