ID: 910222873 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:84906299-84906321 |
| Sequence | AACCATTTTGAAAACCTATT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910222869_910222873 | 23 | Left | 910222869 | 1:84906253-84906275 | CCAACTAGGAGTCTCATACATTG | No data | ||
| Right | 910222873 | 1:84906299-84906321 | AACCATTTTGAAAACCTATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910222873 | Original CRISPR | AACCATTTTGAAAACCTATT TGG | Intergenic | ||