ID: 910225420

View in Genome Browser
Species Human (GRCh38)
Location 1:84931171-84931193
Sequence CACAGCAGGGTGGATTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910225420 Original CRISPR CACAGCAGGGTGGATTGGTT TGG (reversed) Intronic
900116670 1:1032077-1032099 TCCAGCAGGGTGGGGTGGTTGGG + Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
901215522 1:7552748-7552770 CAAAGCAGGGAGGCTGGGTTAGG + Intronic
901700692 1:11043593-11043615 AACAGCAGGGTGGATGCCTTGGG + Intronic
902870285 1:19310108-19310130 CCCAGCTGTCTGGATTGGTTGGG + Intronic
904905447 1:33894407-33894429 CACAGCAGGCTGGAAGGGCTAGG + Intronic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
907811298 1:57872894-57872916 CAAAGCAGGGTGGTGTGATTGGG + Intronic
909880042 1:80864153-80864175 CACAGCAAGTTGTATTTGTTGGG + Intergenic
910225420 1:84931171-84931193 CACAGCAGGGTGGATTGGTTTGG - Intronic
911785918 1:101947533-101947555 CTGAGGAGGGAGGATTGGTTGGG + Intronic
915534108 1:156524263-156524285 CACAGCAGAGTGGAGTGTTGGGG + Intergenic
917042227 1:170818048-170818070 CACAGGAGGGGGAATGGGTTTGG + Intergenic
918294679 1:183145141-183145163 CACAATGGGGTGGTTTGGTTTGG + Exonic
920263634 1:204706447-204706469 GACAGCAGGGAGGAATGTTTTGG - Intergenic
920819931 1:209370821-209370843 CACAGCAGAGTAGATTTGTTAGG + Intergenic
1065806932 10:29402248-29402270 CCAAGGAGGGTGGATTGCTTGGG + Intergenic
1068009088 10:51425579-51425601 CACAGCAGGGAGGCCTGGCTTGG + Intronic
1069910737 10:71757667-71757689 CACAGCAGGGTGGGATGGGAGGG + Intronic
1070543652 10:77435860-77435882 CACTGCCAGGTGGATGGGTTGGG - Intronic
1074061430 10:109969650-109969672 AACAGCAGGGTGGAAAGGGTGGG + Intergenic
1074153491 10:110779194-110779216 CACAGCAGGATGGAAGGGTTGGG + Intronic
1076824327 10:132959617-132959639 CCCTGCAGGGGGGATTGGGTGGG - Intergenic
1077030183 11:462002-462024 CACAGCAGGGTAGGTGGATTAGG + Intronic
1077171392 11:1167796-1167818 CACAGCCGGGTGGACTGGCAGGG + Intronic
1080932135 11:36821936-36821958 CACACCAGTGAGGATTGGATGGG + Intergenic
1081806284 11:45892560-45892582 CATAGCAGGGCGGTTTGGCTTGG + Intronic
1084726249 11:70944271-70944293 CACAGGAGGGTGGATGGCTCTGG - Intronic
1084932929 11:72571271-72571293 GACTGAGGGGTGGATTGGTTGGG - Intergenic
1089712984 11:120330281-120330303 CACAGGAGTGAGGATTGGTGTGG + Exonic
1096755408 12:53795434-53795456 CAGAGCAGGGAGAATTGGTTTGG - Intergenic
1097233623 12:57526182-57526204 CACAGAAGGGAGAATTGGTTGGG - Exonic
1098312741 12:69163844-69163866 CACAGCAGGGATGATTAGGTTGG + Intergenic
1100314913 12:93436198-93436220 GACAGGTGGGAGGATTGGTTTGG - Intronic
1103029611 12:117601976-117601998 CACAGCAGAGTTGAATAGTTGGG - Intronic
1103565712 12:121814362-121814384 CACAGCAGGGTGGGCTGGAGGGG - Exonic
1105768480 13:23584370-23584392 CACAGCAACCTGGATGGGTTTGG - Intronic
1105816669 13:24042442-24042464 CACAGCAGCCTGGTTTGCTTTGG - Intronic
1112483307 13:99796806-99796828 CACAGTAGTGTAGACTGGTTGGG + Intronic
1112817950 13:103295599-103295621 CAGAGAAGGGTTGATTGGCTGGG + Intergenic
1114293769 14:21311060-21311082 CACAGCTGGGTGGTCTCGTTTGG - Intronic
1114349749 14:21836462-21836484 CACAGCAGGGAGGCATGGCTGGG - Intergenic
1115917290 14:38330106-38330128 CATAGCAGGATGGGTTGGTGTGG - Intergenic
1116099679 14:40417507-40417529 CACAGCATGGTGGCTGAGTTCGG + Intergenic
1116712064 14:48381327-48381349 CACAGCAGTGAGGATGGTTTTGG + Intergenic
1119892477 14:78193307-78193329 CACAGCAGGTTGGTATGGCTTGG + Intergenic
1123801066 15:23821293-23821315 CCAAGGAGGGTGGATTGCTTGGG - Intergenic
1123951948 15:25287815-25287837 ATCAGCAAGGTGGAGTGGTTGGG + Intergenic
1126412708 15:48388498-48388520 CACAGCAGGGTGGCTGGTCTTGG + Intergenic
1127785808 15:62353745-62353767 CACAGCATGGAGGTTTGGTGTGG - Intergenic
1128774319 15:70308168-70308190 CCCAGCAGGGTGGAAGGGTATGG - Intergenic
1129185863 15:73906038-73906060 ACCAGCAGGGTGGATGGGATGGG + Intergenic
1132551550 16:555807-555829 GGCAGCAGGGAGGATTGGCTGGG + Intergenic
1135260647 16:20977584-20977606 CACAGCAGGCTGGCCTAGTTAGG + Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1139843156 16:69898425-69898447 CACAGGAGTATGAATTGGTTAGG - Intronic
1140516740 16:75548633-75548655 CCCAGGTGGGTGGATTGCTTGGG + Intronic
1141807903 16:86354125-86354147 CACAGCAGCCTGGTGTGGTTTGG + Intergenic
1143332858 17:6150262-6150284 CACAGCAGGTGGGATGGGCTGGG + Intergenic
1148025807 17:44586875-44586897 CAAAGAAGGCTGGATTGGTATGG - Intergenic
1148850439 17:50551963-50551985 CCCAGCAGGGTGGGTTGCTGGGG - Exonic
1149601766 17:57898105-57898127 CAGAGCAGGAAGGATTGGGTTGG - Intronic
1150642469 17:66958804-66958826 CACATGAGGGTGGAGAGGTTAGG - Intergenic
1151340281 17:73466678-73466700 CACAGCAGGATGGATCATTTTGG + Intronic
1151617350 17:75222276-75222298 CCAAGGAGGGTGGATTGCTTGGG - Intronic
1155167479 18:23243150-23243172 GTCTGCAGGGTGGATTTGTTGGG + Intronic
1156358434 18:36362388-36362410 CACAGAATGGTGGACTAGTTAGG + Intronic
1156530934 18:37814332-37814354 GACAGGAGGGTAGATGGGTTTGG + Intergenic
1156618440 18:38817873-38817895 CTGAGGAGGGTGGATTGCTTGGG + Intergenic
1156887864 18:42156450-42156472 CACATCAGGCTGGAATGGCTGGG - Intergenic
1157522505 18:48355085-48355107 CACTGCAGGGGGGATTGGCATGG - Intronic
1159916937 18:74196455-74196477 CCCAGCAGAGGGAATTGGTTTGG - Intergenic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1161922360 19:7276022-7276044 AACAGCAGGGGAGATGGGTTGGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1168208877 19:54874296-54874318 CACAGGAGGGTGGTCTGTTTGGG - Exonic
1168673583 19:58259950-58259972 CACAGAAGGGTACATTGGCTTGG + Intronic
928181386 2:29071184-29071206 CACAGCAGAGGGGCTTGGCTGGG + Exonic
929272951 2:39993739-39993761 CACCACAGGCTGGAGTGGTTGGG + Intergenic
929852717 2:45607600-45607622 TACTGCAGGGTAAATTGGTTTGG - Intronic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
931633584 2:64322590-64322612 CAGTGGAGGGTGGATTGGGTGGG + Intergenic
932422524 2:71609754-71609776 CACAGGAGTGTGGCTTGGGTTGG + Intronic
932635286 2:73382840-73382862 CAAAGCAGGCTGGAATGTTTTGG + Intergenic
935583331 2:104778793-104778815 AACACCAGGGTGGATTTGTTAGG + Intergenic
936287336 2:111190897-111190919 CAAAGCTGGGTGGATGGGTGGGG + Intergenic
937458551 2:122065915-122065937 CTCAGCAGGGTGGATGAGTCTGG + Intergenic
939254244 2:139721897-139721919 CCCAGCAGGGTGGATAGCTGAGG - Intergenic
939734433 2:145826441-145826463 CACAGATGGCTGGATTGCTTGGG - Intergenic
943909756 2:193548172-193548194 CACAGCAGCTTGGATGGGATTGG + Intergenic
946005064 2:216517917-216517939 CACAGCAAGGTGCATGTGTTAGG - Intronic
946284395 2:218692222-218692244 CACAGCAGGTTGTCTTGGATGGG + Exonic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
949032779 2:241804859-241804881 CAAAGGAGGCTGGAGTGGTTGGG + Intergenic
1169910247 20:10642265-10642287 CACAGCAGTTTGGGATGGTTTGG + Intronic
1173041651 20:39469766-39469788 CACAGAAGGGTGGATCGGCCAGG - Intergenic
1174736351 20:52969389-52969411 CAGGGCAGGGTGGATGGTTTTGG + Intergenic
1175252107 20:57616061-57616083 CACAGCAGGGCTGCTTGGTAGGG - Intronic
1176082815 20:63282415-63282437 CACAGCAGGGTAGATGGGGCTGG + Intronic
1178242775 21:30921876-30921898 GACAGCAGGGTGGATTCTTAAGG - Intergenic
1178348702 21:31854356-31854378 CACAGCAGGGTGACTGGGTTTGG + Intergenic
1179097533 21:38328875-38328897 CCCGGCAGGGGGGAGTGGTTGGG + Intergenic
1179991104 21:44948651-44948673 CACAGCATGGTGGACGGCTTGGG + Intronic
1180196344 21:46196764-46196786 CACGGCAGGGTTGATGGGTGCGG + Intronic
1184782713 22:46657147-46657169 CAGAGGAGGGTGGATGGGCTGGG + Intronic
1184934383 22:47709651-47709673 CTAAGCTGGGTGGATTGTTTGGG + Intergenic
952093817 3:29924142-29924164 CAGAGCAGAGTGGAATGGTTTGG - Intronic
953473573 3:43186871-43186893 CAGAGCATGGTGGAGAGGTTAGG - Intergenic
954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG + Intronic
955392542 3:58531866-58531888 CCCAGGAGGCTGGGTTGGTTGGG - Intronic
958805634 3:98806737-98806759 CACAGCAGGAAGGACAGGTTTGG - Intronic
959645522 3:108695445-108695467 CTCAGCAGGGTGGAGTGTTCTGG - Intergenic
961399972 3:126632924-126632946 CACAACAGGCAGGCTTGGTTGGG + Intronic
961531223 3:127541661-127541683 CACACCAGGCTGGAGTGGCTGGG + Intergenic
963298168 3:143570037-143570059 CCAAGCAGGGAGGATTGCTTGGG - Intronic
966430202 3:179824378-179824400 CAGAGCTGTTTGGATTGGTTTGG - Intronic
969093983 4:4718498-4718520 TTCAGGAGGGTGGCTTGGTTGGG - Intergenic
969661747 4:8534116-8534138 CACAGCAGGATGGGTTTGCTTGG + Intergenic
973920549 4:55680754-55680776 CACAGCAACCTGGATGGGTTTGG + Intergenic
982828380 4:160028095-160028117 CACAGCAGGCTGAAGTGCTTTGG - Intergenic
985787833 5:1909035-1909057 CACAGCAGGGTTGATGGGGGCGG + Intergenic
985830008 5:2221299-2221321 CATAGCAGGGGGCAGTGGTTCGG + Intergenic
987255405 5:16145264-16145286 CACAGCAGGGTTGGTAGGTGGGG + Intronic
987719908 5:21619567-21619589 CACAAAAGGGTGGTATGGTTAGG + Intergenic
990297298 5:54415609-54415631 CAGAGGTGGGAGGATTGGTTAGG + Intergenic
990347976 5:54887703-54887725 CACAGCAGTGTGGATTTTCTAGG + Intergenic
992544969 5:77804568-77804590 CCAAGCAGGGAGGATTGCTTGGG + Intronic
996992664 5:129654501-129654523 CACAGCATGGTGGAAAGCTTTGG + Intronic
997734499 5:136203363-136203385 TACCGCAGGTTGGTTTGGTTGGG + Intergenic
1000338592 5:160260181-160260203 GCCAGGAGGTTGGATTGGTTAGG - Intronic
1001816916 5:174677148-174677170 CAGAGCAGGGTGGGGTGGGTAGG - Intergenic
1002158325 5:177300265-177300287 AACAGGAGGGAGGATTGTTTGGG + Intergenic
1002490825 5:179576012-179576034 CTCAGGAGGGTGGATGGCTTGGG - Intronic
1002767538 6:255425-255447 CACAGTAGAGTGGATTGGAATGG - Intergenic
1006034854 6:31203008-31203030 CAGAGCAGAGTGGAAGGGTTGGG + Exonic
1008054779 6:46935396-46935418 GACACCAGGGTGGAGTGGTGGGG - Intronic
1009035894 6:58116801-58116823 GACAGCAGGGAGGATTTGTGTGG - Intergenic
1009211715 6:60870402-60870424 GACAGCAGGGAGGATTTGTGTGG - Intergenic
1012476168 6:99616574-99616596 CACAGCAGGGGGGCATGGATAGG + Intergenic
1013120122 6:107133704-107133726 CCGAGCAGTGTGGATTGTTTGGG - Intergenic
1013251706 6:108340807-108340829 CACAGGAGGGAGGAATGGATGGG + Intronic
1022107658 7:27208485-27208507 CAGAGCAGGGTTGCTTGGCTGGG + Intergenic
1022291495 7:29008385-29008407 CACAGAAGGGCAGATTGGTGAGG + Intronic
1022655735 7:32318264-32318286 CTCAGAAGGGGGGTTTGGTTTGG - Intergenic
1022950612 7:35334505-35334527 CACAGCATGATGGATGGGGTGGG + Intergenic
1026942612 7:74296199-74296221 CACAGCAGGGTTGTTTTTTTCGG - Intronic
1027608682 7:80332066-80332088 TACAGCAGAGTGGCTTGGCTGGG + Intergenic
1029515475 7:101020635-101020657 CACAGCAGGGTGTGCTGGTGTGG - Intronic
1029690132 7:102175673-102175695 CACAGGAGGGGGGAATGGGTGGG - Intronic
1029743065 7:102502133-102502155 CACAGCAACCTGGATTGGATTGG + Intronic
1029761055 7:102601294-102601316 CACAGCAACCTGGATTGGATTGG + Intronic
1029788227 7:102815166-102815188 CCAAGGAGGCTGGATTGGTTTGG - Intronic
1034698637 7:153077404-153077426 CTCAGCAGGGTGGACTTTTTTGG - Intergenic
1036155958 8:6341967-6341989 CAGAGCAGGCTGGCCTGGTTAGG - Intergenic
1038387463 8:27162581-27162603 CACATCTGGGAGGATTGGATGGG - Intergenic
1040325855 8:46341144-46341166 CACAGCAGGGTGGCATGGGCGGG + Intergenic
1040331508 8:46388072-46388094 GGCAGCAGGGTGGCTTGGTTGGG + Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1042416977 8:68531802-68531824 CATAGGAAGGTGGAATGGTTAGG + Intronic
1043083492 8:75796992-75797014 CAAAGCAGGTTGGATTATTTTGG + Intergenic
1043673538 8:82919860-82919882 CACAGCACTGGTGATTGGTTTGG + Intergenic
1044591571 8:93917658-93917680 CCCGGCGGGGTGGGTTGGTTTGG + Intronic
1046726806 8:117684591-117684613 CACTGCAGAGAGGATGGGTTTGG + Intergenic
1049389344 8:142360101-142360123 CTCAGCAGAGTGCTTTGGTTGGG - Intronic
1050604590 9:7287709-7287731 AGCAGTAGGGTAGATTGGTTGGG - Intergenic
1051638782 9:19205104-19205126 CCCAGGAGGGTGGATGGCTTGGG - Intergenic
1052654372 9:31335722-31335744 CACAGCAGGGAGGTGTGGCTGGG - Intergenic
1060176946 9:121504012-121504034 CACAGCAGGGAGGCTTGGAAGGG + Intergenic
1062258400 9:135642936-135642958 CAAAGGTGGGTGGATTGTTTGGG + Intergenic
1188364421 X:29297219-29297241 CACACCAGGTTGGATTAGTTAGG + Intronic
1190928771 X:54931112-54931134 GACAGCAGGGTGGAAAGGTGAGG + Intronic
1195524332 X:105869125-105869147 GACAGCAGGGTGGAATGTTGAGG + Intronic
1199768159 X:150955429-150955451 AACAGAAGGGTGGATGGGTCAGG - Intergenic
1201269593 Y:12242047-12242069 CACAGCAACGTGGATCAGTTTGG - Intergenic