ID: 910229500

View in Genome Browser
Species Human (GRCh38)
Location 1:84971709-84971731
Sequence CACCTGGCTGGGGGTTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910229493_910229500 0 Left 910229493 1:84971686-84971708 CCTATATACCTTGCAATGCTGAA No data
Right 910229500 1:84971709-84971731 CACCTGGCTGGGGGTTTTACAGG No data
910229495_910229500 -8 Left 910229495 1:84971694-84971716 CCTTGCAATGCTGAACACCTGGC No data
Right 910229500 1:84971709-84971731 CACCTGGCTGGGGGTTTTACAGG No data
910229492_910229500 1 Left 910229492 1:84971685-84971707 CCCTATATACCTTGCAATGCTGA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 910229500 1:84971709-84971731 CACCTGGCTGGGGGTTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910229500 Original CRISPR CACCTGGCTGGGGGTTTTAC AGG Intronic
No off target data available for this crispr