ID: 910232243

View in Genome Browser
Species Human (GRCh38)
Location 1:84998205-84998227
Sequence TTTTCCTATTCCTTGCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910232243_910232245 3 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232245 1:84998231-84998253 AGTTGCCCTGCGCCCGCGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
910232243_910232244 2 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG 0: 1
1: 0
2: 0
3: 3
4: 48
910232243_910232255 26 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232255 1:84998254-84998276 ATGAAAGGCAGGGAGCCGGGAGG 0: 1
1: 0
2: 3
3: 43
4: 421
910232243_910232253 22 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232253 1:84998250-84998272 CGGGATGAAAGGCAGGGAGCCGG 0: 1
1: 0
2: 2
3: 31
4: 338
910232243_910232254 23 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232254 1:84998251-84998273 GGGATGAAAGGCAGGGAGCCGGG 0: 1
1: 1
2: 3
3: 61
4: 845
910232243_910232250 15 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232250 1:84998243-84998265 CCCGCGTCGGGATGAAAGGCAGG 0: 1
1: 0
2: 1
3: 3
4: 36
910232243_910232252 16 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232252 1:84998244-84998266 CCGCGTCGGGATGAAAGGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 55
910232243_910232256 27 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232256 1:84998255-84998277 TGAAAGGCAGGGAGCCGGGAGGG 0: 1
1: 0
2: 5
3: 40
4: 543
910232243_910232248 11 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232248 1:84998239-84998261 TGCGCCCGCGTCGGGATGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910232243 Original CRISPR TTTTCCTATTCCTTGCGCGC CGG (reversed) Intergenic
900154638 1:1199045-1199067 TTCTCCTCTTCCTGGCGCCCTGG - Intergenic
901706969 1:11081293-11081315 TTTGTCTATTCCTTGGGTGCTGG + Intronic
906468852 1:46109959-46109981 TTTTCCTATTACTTTCCCACAGG + Intronic
910232243 1:84998205-84998227 TTTTCCTATTCCTTGCGCGCCGG - Intergenic
911066886 1:93797611-93797633 TTTTCCTATTACTTGGCCCCAGG - Intronic
924589339 1:245388287-245388309 TTTTCCTATTCCTTCCATCCAGG - Intronic
1075928996 10:126278276-126278298 TTTTCTTATTCTTTGCACCCTGG - Intronic
1076694937 10:132242884-132242906 TTTTCCTGTTCTTTGGGCCCAGG - Intronic
1077600586 11:3571883-3571905 TTTTCCTTTTCCTTGTGTTCAGG - Intergenic
1077919955 11:6634245-6634267 CTCTCCTATTCCTTGGGTGCTGG - Exonic
1079352311 11:19702137-19702159 ATTTCCTAGTCCTTGTGCTCAGG + Intronic
1083169010 11:60911234-60911256 TTTTTCTATTCCCTGTGGGCTGG - Intergenic
1084256497 11:67946488-67946510 TTTTCCTTTTCCTTGTGTTCAGG - Intergenic
1087431710 11:98064611-98064633 TTTTCTTATTCCTTGTGCTGTGG + Intergenic
1091805920 12:3355672-3355694 CTTTCCTATTCCCAGCGGGCAGG - Intergenic
1092426720 12:8381198-8381220 TTTTCCTTTTCCTTGTGTTCAGG - Intergenic
1095332806 12:40989236-40989258 CTTTCCTATTCCTTAAGCCCTGG - Intronic
1119971689 14:78977899-78977921 TTTTCCTTTTCCTGGGGTGCTGG + Intronic
1124107129 15:26749727-26749749 TTTTCCTGGTCCTTTCGCGGGGG + Intronic
1127103000 15:55587221-55587243 TTTTCTTCTTTCTTGCGCACTGG - Intronic
1127514079 15:59674849-59674871 TTTTCCTATTTCTTAAGGGCAGG + Intronic
1130342371 15:83010644-83010666 ATTTCCAATTCCTTGGGGGCAGG + Intronic
1133371535 16:5249171-5249193 TTTTCCTTTTCCTTGTGTTCAGG + Intergenic
1138735759 16:59248405-59248427 TTTTCCCATGCCTTGCAGGCAGG + Intergenic
1142613730 17:1123496-1123518 TTTTCCGATTCCTTTGGTGCTGG - Intronic
1144326105 17:14181759-14181781 TTTTCTAATTCCTTGAGGGCAGG - Intronic
1147953101 17:44117893-44117915 ATTTCCTATCCCTTGGGCTCTGG - Intronic
1148947173 17:51273641-51273663 TGTTCCTATTGCTTGAGCTCAGG + Intronic
1150311282 17:64130747-64130769 TCTTCCTTTTCCTTGCCCTCAGG + Intronic
1150361022 17:64534269-64534291 TTTTCCTACTCCTTGTGAGGTGG + Intronic
1155629638 18:27877515-27877537 TTTTCCTATTCCTTAAGCCTGGG - Intergenic
1158055094 18:53269505-53269527 TTTTCCTATTCTTTGCATGCAGG - Intronic
1158631460 18:59118745-59118767 TTTTCCTATTCCTTGAGTATGGG + Intergenic
1164180186 19:22811493-22811515 TTTTCCTAGGCCTTGCTCACAGG + Intergenic
1164534128 19:29072165-29072187 CTTTCATATTCCTTGTGCCCTGG - Intergenic
1166161545 19:40957349-40957371 TTTTCCTCTTCCTTGGGTTCTGG - Intergenic
1167626963 19:50597080-50597102 TTGTTCTATTCCTTGAGCACAGG - Intergenic
925460645 2:4059919-4059941 TTTTCCTATTTCTTGCTCACTGG - Intergenic
930910082 2:56620363-56620385 GTTTGCTATTTCTTGCTCGCTGG - Intergenic
938131854 2:128722893-128722915 TCTTCCTATGCCTTGTGCACTGG - Intergenic
1181992116 22:26845328-26845350 TTTTCCCATTCCTTCCCCCCAGG + Intergenic
1184641900 22:45877309-45877331 TTTTCCTATTTGTTCCCCGCAGG + Intergenic
950549051 3:13655389-13655411 TTTTCCTCTTCCCGGCGCCCCGG + Intergenic
952768147 3:36973301-36973323 TTATCCTATCCCTTGAGCACAGG - Intergenic
956371573 3:68569111-68569133 TTTTCTTGTTCCTTGAGGGCTGG + Intergenic
957071403 3:75570516-75570538 TTTTCCTTTTCCTTGTGTTCAGG - Intergenic
961282717 3:125776221-125776243 TTTTCCTTTTCCTTGTGTTCAGG + Intergenic
963414176 3:144973313-144973335 CTTTCCTTTTCTTTGCGAGCAGG - Intergenic
969015010 4:4098177-4098199 TTTTCCTTTTCCTTGTGTTCAGG - Intergenic
973229352 4:47824052-47824074 TTTTCCTATTCCTTGCTCCTTGG - Intronic
979851618 4:125577913-125577935 TTCTCATATTCCTTGAGCTCAGG + Intergenic
994057312 5:95432895-95432917 TTTTCTTTTTCCTTGCCTGCAGG + Intronic
995310366 5:110703645-110703667 TTTTCCTACTCCTTGTGCAGTGG - Intronic
995963638 5:117876511-117876533 TTTTCCTTTTCCTTCCGCAAAGG + Intergenic
998779379 5:145639638-145639660 TTTTCCTATTCAATGCGATCTGG + Intronic
1001533907 5:172484471-172484493 TTTTCCACTTCCTTGTGCACGGG + Intergenic
1002496390 5:179615368-179615390 TTTTCCTATTCATGGTGGGCAGG + Intronic
1011139968 6:84141869-84141891 TTTTTCTTTTCCTTGAGCACAGG - Intronic
1012956683 6:105578387-105578409 TTTTCCTATTCCTTTCAAGTTGG - Intergenic
1036244011 8:7101440-7101462 TTTTCCTTTTCCTTGTGTTCAGG + Intergenic
1036897831 8:12649987-12650009 TTTTCCTTTTCCTTGTGTTCAGG - Intergenic
1037164898 8:15815490-15815512 TTATCCTATTCCTGGCCCACTGG - Intergenic
1058747631 9:108007394-108007416 TTTTCCTTTTCCCTGAGCCCTGG + Intergenic
1059780540 9:117521771-117521793 TTTTCCTCTTCCTTCAGCGGGGG + Intergenic
1188609219 X:32075620-32075642 TTTTCCTATCCCTTGAGGCCTGG + Intronic
1199667297 X:150107981-150108003 ATTTCCTATTCCTTAAGCGTGGG - Intergenic