ID: 910232244

View in Genome Browser
Species Human (GRCh38)
Location 1:84998230-84998252
Sequence GAGTTGCCCTGCGCCCGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910232243_910232244 2 Left 910232243 1:84998205-84998227 CCGGCGCGCAAGGAATAGGAAAA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910232244 Original CRISPR GAGTTGCCCTGCGCCCGCGT CGG Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
912796246 1:112695340-112695362 GACTTGCCCTGCCCCAGCCTGGG + Intronic
913957636 1:143319332-143319354 GATTTGCCCTGCCCCAACGTTGG - Intergenic
914051947 1:144144696-144144718 GATTTGCCCTGCCCCAACGTTGG - Intergenic
914127250 1:144821845-144821867 GATTTGCCCTGCCCCAACGTTGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
1065590677 10:27258787-27258809 GAGACGCTCTGCGCCCGCGCTGG - Intergenic
1065660318 10:27999059-27999081 GAGACGCTCTGCGCCCGCGCTGG + Intergenic
1084003940 11:66313532-66313554 GAGTGGCCCAGCGCCCCCTTCGG - Intergenic
1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG + Intronic
1091567951 12:1662035-1662057 GACTCGCTCTGCGCCCGCGGAGG - Intergenic
1092274277 12:7047416-7047438 GCGATGCCCTGAGCCAGCGTGGG + Intronic
1114673625 14:24427852-24427874 GAGTGTCTCTGCGCCTGCGTCGG - Exonic
1115755478 14:36523272-36523294 GAGTTTCCCTGCGGCCACGCTGG - Intergenic
1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG + Intergenic
1123421611 15:20140654-20140676 GATTTGCCCTGCCCCAACGTTGG - Intergenic
1123443444 15:20305862-20305884 GATTTGCCCTGCCCCAACGTTGG + Intergenic
1123530837 15:21147194-21147216 GATTTGCCCTGCCCCAACGTTGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG + Intronic
1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG + Intergenic
1160252683 18:77217193-77217215 GTGTTGCACTGTTCCCGCGTGGG + Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1160868968 19:1268427-1268449 GAGTGGGCCTGGCCCCGCGTGGG + Intronic
1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG + Exonic
1167955084 19:53057974-53057996 CGCTTCCCCTGCGCCCGCGTTGG - Intergenic
1202691345 1_KI270712v1_random:97120-97142 GATTTGCCCTGCCCCAACGTTGG - Intergenic
928201280 2:29249251-29249273 GAGTTGCCCTGGGCAGGGGTAGG + Intronic
929532443 2:42761564-42761586 GAGCTGCCCTGAGCCCAGGTGGG + Intergenic
933955044 2:87356830-87356852 GATTTGCCCTGCCCCAACGTTGG + Intergenic
934239235 2:90253044-90253066 GATTTGCCCTGCCCCAACGTTGG + Intergenic
934273950 2:91563654-91563676 GATTTGCCCTGCCCCAACGTTGG - Intergenic
934461677 2:94216398-94216420 GATTTGCCCTGCCCCAACGTTGG + Intergenic
1176592766 21:8659381-8659403 GATTTGCCCTGCCCCAACGTTGG + Intergenic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180275619 22:10636523-10636545 GATTTGCCCTGCCCCAACGTTGG + Intergenic
954424802 3:50437722-50437744 GAGTTGCCCTGGGCTCTCCTGGG - Intronic
976146209 4:82044488-82044510 GAGTGGCCCTGCCCAGGCGTGGG - Intergenic
979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG + Intergenic
984952985 4:185020189-185020211 GAGGTGCCCTGCACCCGCTTTGG + Intronic
1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1044159323 8:88893542-88893564 GAGTTTCCCTGCTCCCACGTTGG - Intergenic
1054272650 9:63045435-63045457 GATTTGCCCTGCCCCAACGTTGG - Intergenic
1054303408 9:63393016-63393038 GATTTGCCCTGCCCCAACGTTGG + Intergenic
1054402188 9:64719526-64719548 GATTTGCCCTGCCCCAACGTTGG + Intergenic
1054435793 9:65203841-65203863 GATTTGCCCTGCCCCAACGTTGG + Intergenic
1054494600 9:65817846-65817868 GATTTGCCCTGCCCCAACGTTGG - Intergenic
1059102539 9:111484065-111484087 GACTGGCCCTGCGCGCGCGGCGG - Exonic
1061625952 9:131840762-131840784 GAGTTGTTCTGCGCCATCGTTGG - Intergenic
1203622811 Un_KI270749v1:138187-138209 GATTTGCCCTGCCCCGACGTTGG + Intergenic