ID: 910238730

View in Genome Browser
Species Human (GRCh38)
Location 1:85063307-85063329
Sequence GCTCCTGGTCCACACCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 187}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910238730_910238745 20 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238745 1:85063350-85063372 AGGGGATTCTCCAGAGAGGGAGG 0: 1
1: 0
2: 3
3: 34
4: 291
910238730_910238740 0 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238740 1:85063330-85063352 AGCAGGAGGGGTGGGAGGGAAGG 0: 1
1: 2
2: 23
3: 746
4: 7291
910238730_910238746 23 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238746 1:85063353-85063375 GGATTCTCCAGAGAGGGAGGTGG 0: 1
1: 0
2: 1
3: 34
4: 354
910238730_910238747 24 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238747 1:85063354-85063376 GATTCTCCAGAGAGGGAGGTGGG 0: 1
1: 0
2: 3
3: 29
4: 374
910238730_910238744 17 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238744 1:85063347-85063369 GGAAGGGGATTCTCCAGAGAGGG 0: 1
1: 1
2: 8
3: 28
4: 319
910238730_910238739 -4 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238739 1:85063326-85063348 GAGCAGCAGGAGGGGTGGGAGGG 0: 1
1: 1
2: 13
3: 173
4: 1437
910238730_910238741 1 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238741 1:85063331-85063353 GCAGGAGGGGTGGGAGGGAAGGG No data
910238730_910238735 -9 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238735 1:85063321-85063343 ACCAGGAGCAGCAGGAGGGGTGG 0: 1
1: 2
2: 10
3: 81
4: 1043
910238730_910238737 -8 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238737 1:85063322-85063344 CCAGGAGCAGCAGGAGGGGTGGG 0: 1
1: 2
2: 5
3: 134
4: 1018
910238730_910238743 16 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238743 1:85063346-85063368 GGGAAGGGGATTCTCCAGAGAGG 0: 1
1: 0
2: 2
3: 31
4: 354
910238730_910238738 -5 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238738 1:85063325-85063347 GGAGCAGCAGGAGGGGTGGGAGG No data
910238730_910238742 2 Left 910238730 1:85063307-85063329 CCTGCATGGTGTGGACCAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 910238742 1:85063332-85063354 CAGGAGGGGTGGGAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910238730 Original CRISPR GCTCCTGGTCCACACCATGC AGG (reversed) Intronic
900798560 1:4724127-4724149 GCTCCTTGTCCACCCCAGCCTGG - Intronic
905150854 1:35926276-35926298 GCTCCAGGACCAAACAATGCAGG - Exonic
906609887 1:47193934-47193956 GCTCCGGGGCCAGACCAAGCTGG - Intergenic
907688482 1:56637807-56637829 CCTCCTTGTCCACACCACTCTGG + Intronic
908390248 1:63677513-63677535 GCTCCTTATCCACAGGATGCTGG - Intergenic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
910450427 1:87337869-87337891 GCTGCAGGACCACACCATGTGGG - Intronic
912435443 1:109657880-109657902 GCTTCTGGTCCAGACCAGGGAGG - Intronic
914437157 1:147670299-147670321 GCTCCTGCTGCACACCGGGCCGG + Exonic
915313481 1:155015975-155015997 GCTCCAGATCCACCCCCTGCTGG - Intronic
921231918 1:213081749-213081771 GCCCCTGTTCCTCACCATGTGGG - Intronic
922372221 1:224922975-224922997 CCTCTTGGCCCACACCAAGCTGG - Intronic
1067295468 10:44973043-44973065 GCTCCTGGTCCAAGCTGTGCTGG + Intronic
1069513243 10:69057502-69057524 CTTCCAGTTCCACACCATGCTGG + Intergenic
1070813171 10:79308461-79308483 GGTCCTGGGCCACACCAGCCAGG + Intronic
1073002017 10:100292982-100293004 TCTCCTGCTCCCCACCCTGCAGG + Exonic
1073772588 10:106751288-106751310 GCTCCTTATCCAAACCATACAGG + Intronic
1076290747 10:129343609-129343631 GCCCCTGGTCCACACAGAGCAGG + Intergenic
1076606287 10:131691795-131691817 CCCCCTGGGCCACACCCTGCGGG + Intergenic
1076739991 10:132478263-132478285 CCTCCTGCTCCTCACCCTGCTGG + Intergenic
1076947602 10:133662082-133662104 GCTCCTGGACAGCAACATGCTGG - Intergenic
1077559439 11:3249360-3249382 GCTACTGGTCCACAGCCTGGCGG + Intergenic
1077565332 11:3295163-3295185 GCTACTGGTCCACAGCCTGGCGG + Intergenic
1078474824 11:11621576-11621598 CTTCCTGGTGCACACCATTCTGG + Exonic
1078919417 11:15815391-15815413 GCTCCTTGTCCACACCCTTTGGG - Intergenic
1079710873 11:23680620-23680642 GCTCCAGATCCTCACCAGGCCGG + Intergenic
1080928539 11:36783762-36783784 GCTCCTGTTCCTTCCCATGCCGG - Intergenic
1083331144 11:61898964-61898986 GCTCCCACTCCACTCCATGCTGG - Intronic
1083750969 11:64760333-64760355 GCTCCTGCACCACAGCCTGCAGG - Intergenic
1084061564 11:66678593-66678615 TCTCCTCGTACACACCAAGCTGG + Intergenic
1084392877 11:68890256-68890278 GCTCCTGGTCCCGCCCATCCCGG - Intergenic
1084393963 11:68896823-68896845 GCCCCTGCTCCACCCCCTGCAGG + Intronic
1086112337 11:83213232-83213254 GTTCCTGGTCCACAACATCAAGG + Intronic
1087180365 11:95135851-95135873 GCTCCAGTTCCACAGGATGCTGG - Intergenic
1089762563 11:120739074-120739096 GCCCTTGGTCCACACCAGCCTGG + Intronic
1090996855 11:131874253-131874275 GCTCTTGTTCCACATCTTGCTGG - Intronic
1091035206 11:132226882-132226904 GCTGCTGGTGTATACCATGCTGG + Intronic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1091312570 11:134585191-134585213 GCTGGTGGCCCACACCCTGCGGG + Intergenic
1097046085 12:56189007-56189029 GCACCCGGTCCACACCCGGCCGG + Intronic
1097070911 12:56354297-56354319 GCTCCTCATCCTCACCACGCAGG - Intronic
1104584244 12:130035133-130035155 GCTCCTGGTCCACAGAAGGCAGG - Intergenic
1104901521 12:132191905-132191927 GCCCCTGGTCAACACCAGCCCGG + Intergenic
1106466840 13:30021182-30021204 GCACCTGCTCCAGACCATCCTGG + Intergenic
1107404219 13:40097907-40097929 GCTCCTGCTCCACTTCTTGCTGG - Intergenic
1107404375 13:40098868-40098890 GCTCCTGCTCCACTTCTTGCTGG - Intergenic
1107417227 13:40211870-40211892 GCTCCTGCTCCCCTCCATCCAGG + Intergenic
1108461389 13:50670944-50670966 GCTCCAGGTCCACAGCTGGCAGG + Intronic
1110611664 13:77494877-77494899 GATCCAGAACCACACCATGCTGG + Intergenic
1112412455 13:99176229-99176251 GAGCCTTTTCCACACCATGCAGG - Intergenic
1119177183 14:72577636-72577658 GCTCCAGGTCCACATGCTGCTGG + Intergenic
1122122420 14:99561584-99561606 GCTCCTGGCTCAGACCTTGCAGG + Intronic
1129150221 15:73683983-73684005 GTTCTTCCTCCACACCATGCTGG - Intronic
1131079443 15:89522582-89522604 TCTCCTGGTCCGCAGCTTGCAGG - Intergenic
1131641973 15:94302587-94302609 GCTCCAGATCCACACCCTACTGG + Intronic
1132484018 16:180979-181001 GCTCCTGGGCCACTGCCTGCTGG + Exonic
1132928679 16:2447123-2447145 GCTCCTGGGCCACAACCGGCTGG + Intronic
1133147748 16:3802747-3802769 GCCCCGGATCCACACCAGGCTGG + Intronic
1133297530 16:4762237-4762259 GCTCCTGGTCTGCAGCATCCTGG - Intronic
1134542077 16:15075767-15075789 GCTCCTGGTGCCCACCATGGCGG + Intronic
1136117776 16:28106120-28106142 GCTCCTGGACCACCACCTGCAGG + Exonic
1137271252 16:46903689-46903711 GCTCCTGCCCCACCCCAGGCAGG - Intronic
1137635842 16:49985966-49985988 GTTCCTGCTCCATACCAGGCAGG + Intergenic
1139504010 16:67390070-67390092 GATCCTGGTCCCCTCCCTGCTGG - Exonic
1140302468 16:73771819-73771841 GCTCCTGGTCCCTGCCATCCCGG + Intergenic
1141930131 16:87196716-87196738 GCTAATGGTCCACCTCATGCTGG - Intronic
1141991616 16:87614126-87614148 GCTCTGTGTCCACACCACGCTGG - Intronic
1203116079 16_KI270728v1_random:1491847-1491869 CCTCCTGGTGCTCACCCTGCAGG - Intergenic
1142711622 17:1726780-1726802 GCTGTTGGTCCAGACCATCCAGG + Exonic
1144093715 17:11881257-11881279 GCTCATCCTCCACACCAAGCTGG + Exonic
1145270440 17:21401870-21401892 TGTCCTGGACCAGACCATGCTGG - Intronic
1145910353 17:28538705-28538727 GCACCTGGGCCACACCCCGCAGG - Exonic
1146184697 17:30717250-30717272 GCTTCTGGCCCTCACCTTGCTGG - Intergenic
1147036643 17:37686544-37686566 GCTCCTGGCCCACAGGAAGCTGG + Exonic
1148769566 17:50059099-50059121 GTTCCTGGTCCACAACATAGGGG + Intronic
1151434534 17:74086764-74086786 GATGCTGGACCACAGCATGCAGG + Intergenic
1152901559 17:82943978-82944000 GCGCCTGTTCCACACCCAGCAGG - Exonic
1153985348 18:10345928-10345950 GCTCCTGGGCCACAGGGTGCTGG + Intergenic
1160508496 18:79440545-79440567 GCCCCTGGGCCACACCCAGCAGG + Intronic
1160609266 18:80073205-80073227 GCTCGTTGTGCACACCTTGCTGG + Intronic
1160658517 19:287455-287477 GCTGCTGGTCCACACCCACCTGG + Exonic
1160910544 19:1471914-1471936 GCTCCGGGCCCACACCCTGCAGG + Exonic
1161395632 19:4043644-4043666 GATCCTGGTCCACAGCCTCCAGG + Intergenic
1161979636 19:7623865-7623887 GCTCCAGGTCCACATCATCTGGG + Exonic
1162950698 19:14070676-14070698 GCTCCTGTACCACGCCACGCAGG - Intergenic
1162974084 19:14198443-14198465 GCTTCTGGCCCCCACCTTGCTGG + Intronic
1164825771 19:31283947-31283969 GAACCTGGTCCCCACCAGGCTGG + Intronic
1165788296 19:38475443-38475465 GTTACTGGTCCACACCGTGGTGG - Exonic
1166274054 19:41739151-41739173 GCTCTTGGTCCCCACCATCTGGG - Intronic
1166381233 19:42356358-42356380 CCGCCTGGGCCACACCATGGTGG + Exonic
1167645902 19:50704653-50704675 GCTCCTGGTCCGTACCTGGCAGG - Intronic
1168339277 19:55614329-55614351 GCACCTGGTCCAGCACATGCTGG + Exonic
925409768 2:3633197-3633219 TCTCCTGGGCCTCACCATCCCGG - Intronic
925967998 2:9084109-9084131 GCTCCTGGTCTACAGCATCATGG + Intergenic
928169717 2:28995409-28995431 GCCCCTGCTCCAGCCCATGCAGG - Intronic
929654319 2:43715431-43715453 GCTCCTGTTACAAACCCTGCAGG - Intronic
929829589 2:45336137-45336159 GCCCCTGGACCACTCCATGTGGG - Intergenic
932301034 2:70667163-70667185 GCTCCAGGTTCCCACCATTCAGG - Intronic
937233881 2:120418756-120418778 ACTCCTGGGCCACACCACCCAGG + Intergenic
938119245 2:128622315-128622337 GGTCCTGGCCCACACAATCCAGG - Intergenic
938191156 2:129281963-129281985 GCTCCTTGTCCACACCCAGCAGG + Intergenic
940175105 2:150870195-150870217 GCTCCTGGCCCACACCCAGAAGG - Intergenic
942050350 2:172134415-172134437 GTTCCTGCTCCACACAATTCTGG + Intergenic
944163646 2:196693669-196693691 GCTCCTATTCCACATCATACAGG - Intronic
944188870 2:196979935-196979957 TCCCCTGCTCCACACCATCCAGG + Intronic
947635861 2:231680618-231680640 TCTCCTGCTCCAAACCCTGCCGG + Intergenic
1169207874 20:3750115-3750137 ACTGCTGGCCCACACCGTGCAGG + Exonic
1169414114 20:5401245-5401267 CCTCCTGCTCCATTCCATGCTGG + Intergenic
1170846708 20:19968153-19968175 GCTCCTGATCCACAGAATGGGGG + Intronic
1170884793 20:20330684-20330706 GCTCCTGGACCAGACCATGGGGG + Intronic
1171464957 20:25320856-25320878 GCTCATGGTCCACACCTGGCTGG + Intronic
1172776369 20:37409543-37409565 CATCCTGATCCCCACCATGCAGG + Intergenic
1173225959 20:41162620-41162642 ACTCCTGCTCTATACCATGCAGG + Exonic
1173522332 20:43709434-43709456 GCTTCTGGACCAGACCATCCTGG + Intronic
1174148409 20:48468622-48468644 GCACCTGCTCCAGGCCATGCAGG - Intergenic
1175036251 20:56004108-56004130 GCTGCTGGTCCTCACGCTGCCGG - Exonic
1175256036 20:57647807-57647829 GCTCCTGGTGCACAAGATGGAGG - Intergenic
1178919230 21:36727913-36727935 GCTCCTTGTCGACACCCTTCAGG + Intronic
1179190642 21:39119124-39119146 GCTCCTGGTCACCTCCCTGCGGG - Intergenic
1179540600 21:42081187-42081209 GCCCCTGGTCATCAGCATGCGGG - Intronic
1179923561 21:44520577-44520599 GCTCCTGGTCCGGCCCCTGCGGG + Intronic
1180188369 21:46151394-46151416 CCTCCGCGTCCACACCGTGCGGG - Intronic
1180221026 21:46358022-46358044 GCTCAGGGTCCATCCCATGCTGG + Intronic
1180259487 21:46658960-46658982 CCTCCTGGTCCACAGTCTGCAGG + Intronic
1180625892 22:17193132-17193154 GTTCCTGGTCCACAACATCAAGG + Intronic
1181749357 22:24977960-24977982 TTTCCTGCTCCACACCCTGCTGG - Intronic
1182584084 22:31333597-31333619 GGTGCTGGTCCAACCCATGCTGG - Intronic
1185017099 22:48351220-48351242 CCTCCTGGTCCACGCCATGCTGG + Intergenic
950521493 3:13500416-13500438 GCTCCTTGTCCCCACCAAGCTGG - Intronic
952955667 3:38555806-38555828 GATCCTGGTGCCCTCCATGCTGG - Intronic
953850855 3:46464635-46464657 GCTCCTGTTCCTCCCCATGTGGG + Intronic
954205038 3:49052462-49052484 GCTCCAGGGCCAGCCCATGCAGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954943015 3:54392594-54392616 CCTCCTGGTCCTCACCAAGCTGG + Intronic
958097922 3:88971602-88971624 ACTCCTACTCCACACCATTCAGG + Intergenic
961443140 3:126964760-126964782 CCTCCAGGTGCACACCCTGCTGG - Intergenic
961642277 3:128371953-128371975 ACTCCTGGTCCGCACCAGGCTGG - Intronic
962755703 3:138464216-138464238 TCTCCTGGTCCAGACCGTGGAGG + Intronic
966872822 3:184302712-184302734 GCTCCAGGAACACCCCATGCCGG - Exonic
968629535 4:1642819-1642841 CCTCCTCGACCACACCACGCTGG + Intronic
969204370 4:5631978-5632000 GCTCCTGTTCCAGGCCATGGAGG + Exonic
973272132 4:48271922-48271944 GGTACTGGTCCACAGCCTGCGGG + Intergenic
973285434 4:48410768-48410790 GATACTGATCCACAGCATGCAGG - Intronic
975741401 4:77432545-77432567 GCTAATGGTCCACACCTTTCAGG + Intronic
983296735 4:165875578-165875600 TCTCCTTGTCCAAACCATCCGGG - Intronic
985616386 5:924640-924662 GCCCCTGGTCCAATCTATGCAGG - Intergenic
986715413 5:10520194-10520216 GCTCCTGGTCGACACAAAGGTGG + Intronic
987099812 5:14581890-14581912 GCTCCTTGTCGCCGCCATGCCGG - Exonic
987398048 5:17443933-17443955 CCTCCTGTTGCACACCCTGCGGG + Intergenic
992074083 5:73174929-73174951 GCTCTTGGTCCACCCCAGGCTGG + Exonic
997965496 5:138352941-138352963 GCTCATGGCCCGCACCGTGCCGG - Exonic
998368405 5:141645818-141645840 GCTCCTGCTCCACCTCATCCTGG + Exonic
998386558 5:141760489-141760511 GCTCTTGGTCCCCACTCTGCAGG - Intergenic
998467559 5:142357587-142357609 GCTCTTGGAACACACCATGCAGG + Intergenic
998482584 5:142475084-142475106 TCTTCTGCCCCACACCATGCTGG + Intergenic
998649803 5:144105868-144105890 GCTCCTGCTCCATGCCATGCTGG + Intergenic
1000973456 5:167739548-167739570 GCTCCTGGTTCCCATCTTGCTGG + Intronic
1001206892 5:169772135-169772157 GTCTCTGGTCCACAACATGCAGG + Intronic
1001377518 5:171276098-171276120 GCTACTGGTGCACAGCATGAAGG + Intronic
1002386936 5:178875405-178875427 CCTCCTGCTCCTCACCAGGCAGG - Intronic
1004160179 6:13205951-13205973 GGTGCTGGGCCACACCCTGCTGG - Exonic
1006984406 6:38167484-38167506 GCTCCATTTCCAAACCATGCAGG - Intergenic
1018080999 6:160259236-160259258 GATCCTGGTTCACATCACGCTGG - Intronic
1018549782 6:164982469-164982491 CCTTCTGGACCACAACATGCAGG + Intergenic
1018700136 6:166419886-166419908 GATCCTGTTGTACACCATGCTGG - Exonic
1018700162 6:166420042-166420064 CCTCCTGGTCCCCAGCTTGCCGG - Intronic
1019408939 7:898328-898350 GCTCCTGGTCCTCACCTGGAGGG - Exonic
1019670981 7:2278192-2278214 GCTGCTGTCCCACACCCTGCAGG - Exonic
1021585562 7:22203739-22203761 AGCCCTGGTCCACAGCATGCAGG - Intronic
1023759382 7:43449759-43449781 CCTCCTGCCTCACACCATGCTGG - Intronic
1023899972 7:44468124-44468146 GTTCCTGGTCCACAACATCAAGG + Intronic
1024167619 7:46750357-46750379 GCTCCAGATCCACAGCAGGCAGG - Intronic
1033341515 7:140495794-140495816 GGTCCTGGATCACACCAAGCAGG - Intergenic
1035317559 7:158006368-158006390 GCTCCAGGGCCAGACCAGGCTGG - Intronic
1035460492 7:159035616-159035638 GCTCCGGGTAAACAACATGCAGG + Intronic
1036043221 8:5109794-5109816 GCTCCAGGTGCACACGCTGCGGG + Intergenic
1037916212 8:22774978-22775000 GCTCCTGGGTGACACCATCCTGG + Intronic
1037965194 8:23128470-23128492 CCCCTTGGTCCACACCCTGCAGG + Intergenic
1040894319 8:52350014-52350036 CCTCCTGTTCCACACCCCGCAGG + Intronic
1041594588 8:59633401-59633423 TTTCTTGGTCCACTCCATGCTGG + Intergenic
1041702227 8:60803970-60803992 ACTCTGGGTCAACACCATGCAGG - Intronic
1045905367 8:107338437-107338459 CCTCCTGTTCCACCCCTTGCGGG - Intronic
1047177676 8:122556949-122556971 GCTAATGGTCCACTCCATGAAGG - Intergenic
1047224674 8:122946219-122946241 GGTGCTGGTCCTCACCTTGCTGG + Intronic
1048930775 8:139314084-139314106 GGTCCTGGTTCACCCCATTCTGG + Intergenic
1049755726 8:144310554-144310576 GCTCCTGCTAGACCCCATGCAGG - Intronic
1050361740 9:4836965-4836987 TCTCCTGGTACACACAAGGCTGG - Intronic
1051165719 9:14260249-14260271 TCTCCTGGTCCACCCCAGGATGG + Intronic
1054462103 9:65470928-65470950 GCACCTGGTCAACACCAAGTGGG + Intergenic
1059431333 9:114252267-114252289 GATCCTGGCCCACATCATGTTGG - Intronic
1061227298 9:129288156-129288178 GGCCCTGGTCCACGCCATGGGGG - Intergenic
1061286914 9:129628959-129628981 ACTACTCTTCCACACCATGCTGG - Intronic
1061288113 9:129635726-129635748 GCTCCTGGTGCTCCCCATGTGGG + Exonic
1062030574 9:134360149-134360171 GATCCTGGCCCACCCCAGGCAGG - Intronic
1062267523 9:135694086-135694108 GCCCCTGGTCCAGCCCGTGCTGG - Intronic
1062582678 9:137235458-137235480 GGTCCTGCTCCACCCCCTGCAGG + Intronic
1185802289 X:3024028-3024050 GCTCCTGGTCCAGGGCATCCAGG - Exonic
1189496637 X:41514708-41514730 GCTCCTGGTGCCCATCCTGCAGG - Intergenic
1191663448 X:63673641-63673663 TCTCCTGTTCCCAACCATGCAGG - Intronic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic