ID: 910241422

View in Genome Browser
Species Human (GRCh38)
Location 1:85090751-85090773
Sequence CTAAGCTGTTAGTAGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910241416_910241422 24 Left 910241416 1:85090704-85090726 CCTGCACTCTTACTGGCTTTGAA 0: 1
1: 0
2: 1
3: 12
4: 136
Right 910241422 1:85090751-85090773 CTAAGCTGTTAGTAGGACCCTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910241422 Original CRISPR CTAAGCTGTTAGTAGGACCC TGG Intronic
905537133 1:38731036-38731058 CTAATCTGTTAGTAGAACACAGG - Intergenic
908472873 1:64460989-64461011 CTAAGCTGTTATTATGAGTCAGG + Intergenic
908486223 1:64596436-64596458 TTAGGCTGTTACTAGGGCCCAGG + Intronic
908671730 1:66555511-66555533 CTAAGCTTTTATTATGAGCCTGG - Intronic
910241422 1:85090751-85090773 CTAAGCTGTTAGTAGGACCCTGG + Intronic
916784942 1:168079942-168079964 CTAAGCTATTACTACTACCCAGG + Exonic
916982466 1:170153673-170153695 TTAAGCTGTTAGAAGCAGCCAGG - Intronic
920349711 1:205329750-205329772 CTAGGCTGTGATTAGGACCAAGG + Intergenic
920689199 1:208132770-208132792 CTAAGCGGGTAGTAGGTTCCTGG + Intronic
923044067 1:230342205-230342227 CTAAGCTGTTGCTGGGATCCGGG + Intronic
923139907 1:231152275-231152297 CTAAGCTATTAGAAGCAGCCAGG + Intergenic
1062860705 10:807154-807176 CTGATCTGTCATTAGGACCCTGG - Exonic
1066083417 10:31954714-31954736 CTATGCTGTTAGCAGCAGCCAGG - Intergenic
1067575194 10:47404370-47404392 CAAAGCTGTAAGTGGGGCCCAGG - Intergenic
1075274513 10:121081036-121081058 CTAAGCAGTTACTATGAACCAGG - Intergenic
1080406949 11:31987777-31987799 TTGAGCTGTTATTAGAACCCAGG - Intronic
1081142061 11:39513595-39513617 ATAAGTAGTTAGGAGGACCCAGG - Intergenic
1084433914 11:69127057-69127079 CTAAGCTGCTAGGAGGGCCTGGG - Intergenic
1085297824 11:75440962-75440984 CTAAGGTGCTGGGAGGACCCTGG - Intronic
1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG + Intronic
1088580148 11:111307703-111307725 CTAAGCTGTAGGTGGCACCCTGG - Intronic
1091868064 12:3859988-3860010 TTAAGCAGTCAGGAGGACCCAGG - Intronic
1096916600 12:55039931-55039953 GTAAGATGTCAGGAGGACCCGGG + Intergenic
1097142543 12:56914852-56914874 CTAAGCTGTTAATAGAACCTTGG + Intergenic
1097716052 12:62967362-62967384 GTAAGCAGTTAGTCTGACCCAGG + Intergenic
1101440069 12:104697178-104697200 CGAAGCAGTGAGGAGGACCCAGG - Intronic
1103213830 12:119186648-119186670 CTAACCTGCCAGTAGAACCCTGG - Intronic
1105606286 13:21929163-21929185 CTTATCTGGTTGTAGGACCCAGG + Intergenic
1107088193 13:36448280-36448302 CCAAGCTGGAATTAGGACCCAGG - Intergenic
1112252422 13:97794446-97794468 CTAGGCTGTTAGAAGCAGCCAGG + Intergenic
1115788472 14:36853475-36853497 CTAAGCTGCTAGGCAGACCCAGG + Intronic
1120555453 14:85924530-85924552 CAAAGCTGTTATTTGAACCCAGG - Intergenic
1128921340 15:71612785-71612807 CTAAGCTTTTTGGAGTACCCTGG - Intronic
1146267173 17:31460356-31460378 CCAAGCTGTGATTCGGACCCAGG - Intronic
1149379053 17:56074443-56074465 CTTAGCTCCTAGTAGAACCCAGG - Intergenic
1151274415 17:73023168-73023190 CTCAGCTGTTAGTTGGGCACTGG - Intronic
1151901925 17:77021869-77021891 CTAGGCTGTTAGAAGCAGCCAGG - Intergenic
1153556827 18:6323641-6323663 CTAGGCTGTTAGAAGCAGCCAGG - Intronic
1156736180 18:40262725-40262747 ATAAGTTGTTAGTAGCAGCCAGG - Intergenic
1158312041 18:56169550-56169572 ATAAGTTGGGAGTAGGACCCAGG - Intergenic
1158763532 18:60419774-60419796 AAAACATGTTAGTAGGACCCAGG + Intergenic
1159892390 18:73964870-73964892 ATATGCTGTTAGGAGGAGCCAGG + Intergenic
1165085838 19:33346579-33346601 CTAAGCATTTAGTATGAACCAGG - Intergenic
925061700 2:896592-896614 CTAAGCTATTAGAAGCAGCCAGG - Intergenic
927251424 2:20998011-20998033 CTCATCTGTTACTTGGACCCTGG + Intergenic
927530203 2:23790539-23790561 CTAAGGTGTTGGTAGTAACCTGG - Intronic
929593682 2:43162549-43162571 CAGAGCTGGGAGTAGGACCCAGG - Intergenic
929605328 2:43230239-43230261 CTTAGCTGTGAGGAGGAACCTGG - Intergenic
930305374 2:49668683-49668705 ATAGGCTGTTAGAAGGAGCCAGG + Intergenic
931174842 2:59843547-59843569 CTAGGATGTTAGCAGCACCCTGG + Intergenic
932699461 2:73983704-73983726 CTAAGCTGTTAGCTGCAGCCGGG + Intergenic
946234595 2:218315989-218316011 CCAAGCTGTGAGTGGGATCCAGG + Intronic
1169608731 20:7354094-7354116 CTAGGCTGTGACTAGAACCCAGG - Intergenic
1172632026 20:36385075-36385097 CTAAGTTGGCAGTAGGACTCAGG + Intronic
1173114191 20:40224442-40224464 TGAAGCTGTTATGAGGACCCAGG + Intergenic
1173523480 20:43715756-43715778 CTCAACTGTAAGTAGGACGCTGG - Intronic
1175019687 20:55831808-55831830 CTCAGCTGTGACTAGGATCCTGG + Intergenic
1175226938 20:57450184-57450206 CTAAGCTGTGAATAGTGCCCTGG - Intergenic
1178472554 21:32906366-32906388 CTAAGCTGTTACTATTTCCCAGG - Intergenic
1183616851 22:38950854-38950876 CTAAGCTGTGAGTGAGCCCCAGG + Intergenic
1183969148 22:41463163-41463185 CTAAGCTGTAAGTAGGCCAGGGG - Intronic
1184173303 22:42772158-42772180 ATAAGGTGTTAGAAGGACACAGG + Intergenic
949185912 3:1191309-1191331 CCAAGCTGTTAGTAGAAGCTTGG + Intronic
952949823 3:38513758-38513780 CTAAGCTTTTACTAGGTACCTGG + Intronic
955392412 3:58531159-58531181 CTAAGCTCTATGGAGGACCCAGG + Intronic
955672932 3:61420870-61420892 CTCTGCTGTTAGCATGACCCAGG + Intergenic
958869459 3:99540295-99540317 CAAAGCTGAGACTAGGACCCAGG + Intergenic
960150585 3:114245194-114245216 TTAAGCTGTTAGAAGCAGCCAGG - Intergenic
961318764 3:126058078-126058100 CTGGGCTGTGAGCAGGACCCTGG - Intronic
962664678 3:137642109-137642131 CTAGACTGTGAGTAGGACCCTGG - Intergenic
975637320 4:76463361-76463383 CTAAGCTGTTAGAAGCAGCCAGG - Intronic
979429682 4:120613889-120613911 TTAAGCTTTTAGGAGGACCTTGG + Intergenic
979610152 4:122681463-122681485 CTATGCTGTTAGCAGAAGCCAGG - Intergenic
986601494 5:9477702-9477724 ATATGCTGTTAGGAGCACCCAGG - Intronic
991355832 5:65767769-65767791 GTATGCTGTTAGGAGCACCCAGG + Intronic
993744346 5:91577687-91577709 CTAAGCTATGAGTAGTACACAGG + Intergenic
995257122 5:110059608-110059630 CTAAAATGTCAGTAGTACCCAGG + Intergenic
995851326 5:116549151-116549173 GTATGCTTTTAGTAGGTCCCTGG - Intronic
996143027 5:119938163-119938185 TTAAGCTGTTAGATGGAACCAGG + Intergenic
996189775 5:120525780-120525802 ATAAGCCTTTAGGAGGACCCGGG + Intronic
996212416 5:120827903-120827925 CTGAGTAGTTAGTAGGACCCTGG + Intergenic
1002787555 6:415265-415287 ATAAGCTGTTAGAAGCAGCCAGG - Intergenic
1011245527 6:85317686-85317708 ATAGGCTGTTAGAAGGAGCCAGG - Intergenic
1012663934 6:101942725-101942747 GTATGCTGTTAGTAGAAGCCAGG - Intronic
1014049539 6:116936036-116936058 CTGAGTTGTGAGTAGGGCCCTGG + Intergenic
1023690228 7:42778822-42778844 GTATGCTGTTAGAAGGAGCCAGG - Intergenic
1024022775 7:45386795-45386817 CTAAGCAATGAGGAGGACCCTGG - Intergenic
1024219288 7:47275407-47275429 CTGAGTAGTTAGTAGGACCCTGG + Exonic
1035547840 8:497471-497493 GTATGCTGTTAGGAGCACCCAGG - Intronic
1035559764 8:595487-595509 CTGAGCAGTTAGTGGAACCCAGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1044852195 8:96440059-96440081 ATATGCTGATAGAAGGACCCAGG - Intergenic
1047683242 8:127276766-127276788 ATGAGTTGTTAGCAGGACCCTGG - Intergenic
1050091761 9:2022249-2022271 TGAAGCTGTTAGAAGGATCCTGG + Intronic
1052534692 9:29732104-29732126 CAAACCTGATAGTAGAACCCAGG + Intergenic
1060168284 9:121439112-121439134 GTGAGCTTTTAGTGGGACCCTGG + Intergenic
1061619305 9:131801102-131801124 CTATGCTTTTAGAAAGACCCTGG + Intergenic
1187900154 X:24020484-24020506 CTAAGCTATTAGGAGGGCCCTGG + Intronic
1193143595 X:78054908-78054930 ATATGCTGTTAGAAGGAGCCAGG + Intergenic
1193421891 X:81292742-81292764 CTATGCTGTTAGAAGCAGCCAGG + Intronic
1194168839 X:90556832-90556854 ATAAGCTGTTAGCAGTAGCCAGG - Intergenic
1196291795 X:113950484-113950506 CTATGCTGTTAGTACAACTCAGG - Intergenic
1197648713 X:129042549-129042571 CTAGGCTGGGAGCAGGACCCGGG + Intergenic
1197744667 X:129923919-129923941 CAAAGCTGGGAATAGGACCCAGG + Intronic