ID: 910241598

View in Genome Browser
Species Human (GRCh38)
Location 1:85092608-85092630
Sequence TCTAGGGACCTTGGTTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910241598_910241602 8 Left 910241598 1:85092608-85092630 CCTGTCAAACCAAGGTCCCTAGA No data
Right 910241602 1:85092639-85092661 AAATGATCCTAGCACTCAGATGG 0: 1
1: 0
2: 0
3: 18
4: 195
910241598_910241604 19 Left 910241598 1:85092608-85092630 CCTGTCAAACCAAGGTCCCTAGA No data
Right 910241604 1:85092650-85092672 GCACTCAGATGGTATCTTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910241598 Original CRISPR TCTAGGGACCTTGGTTTGAC AGG (reversed) Intronic
No off target data available for this crispr