ID: 910243366

View in Genome Browser
Species Human (GRCh38)
Location 1:85112440-85112462
Sequence CTATTCCTAGGGATGTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910243366_910243371 -1 Left 910243366 1:85112440-85112462 CCTGGGTACATCCCTAGGAATAG 0: 1
1: 0
2: 1
3: 21
4: 137
Right 910243371 1:85112462-85112484 GAATGGTTGTATTATATGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 194
910243366_910243370 -5 Left 910243366 1:85112440-85112462 CCTGGGTACATCCCTAGGAATAG 0: 1
1: 0
2: 1
3: 21
4: 137
Right 910243370 1:85112458-85112480 AATAGAATGGTTGTATTATATGG 0: 1
1: 1
2: 3
3: 54
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910243366 Original CRISPR CTATTCCTAGGGATGTACCC AGG (reversed) Intronic
901309874 1:8261051-8261073 CTAGTCCTAGGGCTGCACACGGG + Intergenic
909505224 1:76380450-76380472 CTATTTCTAGGTGTATACCCAGG + Intronic
910243366 1:85112440-85112462 CTATTCCTAGGGATGTACCCAGG - Intronic
911249963 1:95564213-95564235 TTACTCCTAGGTATTTACCCAGG - Intergenic
913230275 1:116735566-116735588 CTAGTTCTTGGAATGTACCCAGG - Intergenic
918530205 1:185511380-185511402 CTACTCCTAGGAATTTACCCAGG - Intergenic
918842228 1:189556479-189556501 CTATGCCTAGGTATGTACAAAGG + Intergenic
920034578 1:203057729-203057751 CTATTGATAGAGATGTGCCCAGG + Intronic
923392500 1:233527803-233527825 CTATTCCTAAGTATTTATCCTGG + Intergenic
923698028 1:236273840-236273862 CTATTCCTAAGCATATAACCTGG - Intronic
1063814115 10:9752852-9752874 CCAATCCTAGGGCTTTACCCAGG + Intergenic
1070443839 10:76474842-76474864 CCACTCCTAGGTATATACCCAGG + Intronic
1071738899 10:88334087-88334109 CTATTACTAGGAATTTATCCTGG - Intronic
1072989176 10:100174178-100174200 CTTTTCCTAGGGAAGTTCTCTGG - Intronic
1075462615 10:122628158-122628180 GTATTCCTAGGTATATACCCAGG + Intronic
1075850514 10:125582403-125582425 CTGTTTTTAGGGATGCACCCTGG - Intronic
1076983109 11:215719-215741 CTTCTCCTGGGGCTGTACCCAGG - Exonic
1077446749 11:2596325-2596347 CTATTCCTAGGTATTTATCCAGG + Intronic
1077956226 11:7022294-7022316 AGATGCCTAGAGATGTACCCAGG + Intronic
1082753225 11:57045105-57045127 CTTTTCCCAGGTATATACCCTGG + Intergenic
1082919416 11:58476573-58476595 CTATTTCTAGGTATATACTCAGG + Intergenic
1088897629 11:114090324-114090346 CTATTCCCAGGGCTGTAACGTGG + Intronic
1089220636 11:116868474-116868496 CTATTCCTAGAGATGAACCTGGG + Intronic
1092281146 12:7098453-7098475 CTACTGCTAGGTATATACCCAGG + Intronic
1092779812 12:11975380-11975402 CTATTCCTGGGTATATACTCAGG + Intergenic
1096813038 12:54183681-54183703 CTCTTCCTGGGCATGAACCCTGG - Exonic
1097682672 12:62663566-62663588 CTACTCTTAGGTCTGTACCCTGG - Intronic
1104884361 12:132096901-132096923 CTTTTCCTAGGTAAGTACCTAGG + Intronic
1108240787 13:48461496-48461518 CTACTCCTAGGTATGTACCTAGG - Intronic
1110071452 13:71183835-71183857 CTACTTCTAGGTATTTACCCAGG + Intergenic
1110253187 13:73403446-73403468 CTATGCTTAGGCATATACCCTGG + Intergenic
1111770378 13:92588602-92588624 CTCTTTCTAGGCATGTGCCCTGG + Intronic
1111770574 13:92590908-92590930 CTCTTTCTAGGCATGTGCCCTGG + Intronic
1113565840 13:111319209-111319231 CCACTCCTAGGGATATACCAAGG + Intronic
1115485937 14:33911430-33911452 ATATTCCACGGGATGGACCCAGG - Intergenic
1117351100 14:54882966-54882988 CTATGTGTAGGGATGGACCCAGG + Intronic
1118221379 14:63857474-63857496 CTACTCCTAGACATCTACCCAGG - Intronic
1119176532 14:72572283-72572305 CCATTCATAGGTATATACCCAGG + Intergenic
1121609892 14:95270818-95270840 CTACTCCTAGGTGTATACCCAGG - Intronic
1121726432 14:96155240-96155262 CTGCTCCTAGGTATTTACCCAGG + Intergenic
1121813440 14:96911403-96911425 CAAGTCTTAGGGATGGACCCAGG + Intronic
1122000821 14:98651016-98651038 CTATGCCTAGGGAGGTAAGCTGG + Intergenic
1125611228 15:40972143-40972165 CCATTCCTAGGTACATACCCAGG - Intergenic
1128316646 15:66663699-66663721 CAGTTCCTAGGTATTTACCCAGG - Intronic
1128348647 15:66874058-66874080 CTCTTCCCAGGCATGTACCCGGG + Intergenic
1130300912 15:82679615-82679637 CTATTCCTGGGGCTGAGCCCAGG - Intronic
1130367134 15:83250799-83250821 CCACTCCTAGGTATATACCCAGG + Intergenic
1131337175 15:91560526-91560548 CAATTCCTGGGGATGGACTCAGG + Intergenic
1133016821 16:2946984-2947006 CCACTCCTAGGTATGTACCCAGG + Intronic
1133595183 16:7284275-7284297 CCACTCCTAGGAATTTACCCAGG - Intronic
1134308022 16:13050899-13050921 CTATGCATAGGGGTTTACCCAGG - Intronic
1138243154 16:55445383-55445405 CTCTCCCTAGGGATGTGGCCTGG + Intronic
1141442490 16:84038500-84038522 GTATTCCAGGGGATGTACACTGG - Intronic
1146544063 17:33723049-33723071 CCATTCCTAAGGATACACCCAGG + Intronic
1151646845 17:75438328-75438350 CCACTCCTAGGCATCTACCCAGG + Intergenic
1152511722 17:80794550-80794572 CTACTCCTGGATATGTACCCTGG + Intronic
1157921890 18:51721626-51721648 CTATGCCTAGGTATGCTCCCTGG + Intergenic
1158829186 18:61259198-61259220 TTTTTCCTAAGGAGGTACCCAGG - Intergenic
925606676 2:5667097-5667119 GTACTCCTAGGGATCTACCTGGG - Intergenic
925895335 2:8467195-8467217 CTACTTCTAGGGATGTACCCCGG - Intergenic
928601387 2:32907220-32907242 CCACTCCTAGGTATATACCCAGG + Intergenic
931612965 2:64123781-64123803 CAATTCCTAGGTATATACCCAGG + Intronic
931929551 2:67115047-67115069 CTATTCCTAATTATTTACCCTGG - Intergenic
932171542 2:69562071-69562093 TTTCTCCTAGGTATGTACCCAGG + Intronic
933562989 2:83912602-83912624 TTATTCCTAGGGTTATTCCCAGG + Intergenic
933814780 2:86057450-86057472 CTACTTCTAGGTATATACCCAGG + Intronic
937277468 2:120694631-120694653 CTCTTCCTTGGGCTGTACCAGGG + Intergenic
937306977 2:120877869-120877891 CCATTCCTAGGTATATACCTGGG - Intronic
937865248 2:126746202-126746224 CTATGCCTAGGGCTGAACCTGGG + Intergenic
937985657 2:127637056-127637078 CTGGTCCTGGGGATGCACCCAGG - Intronic
938249517 2:129803454-129803476 CTACTCCTAGGCATATACCCAGG + Intergenic
940180064 2:150922151-150922173 ACATTCCGAGGGATGTAACCTGG - Intergenic
942948196 2:181692675-181692697 CTATTCTTAGGGATATACCTAGG - Intergenic
943904268 2:193477515-193477537 CTACTCCTAGGTATTTACCAAGG + Intergenic
944277706 2:197858157-197858179 CTATTGGTAGGGAGGTAGCCTGG + Intronic
946310864 2:218881866-218881888 CTATTCCTGGGGATGTGCATAGG + Intronic
947086901 2:226463487-226463509 AGATTCCTAGGTATTTACCCAGG + Intergenic
948547136 2:238740800-238740822 CCACTCCTAGGCATGTACCCAGG + Intergenic
1172394295 20:34588809-34588831 CCATTTCTAGGTATGTATCCTGG + Intronic
1172920040 20:38473290-38473312 CTAATCCTTGGGAGCTACCCCGG + Intronic
1172961276 20:38801918-38801940 CTACTCCTAGGTATATACTCAGG - Intergenic
1173214289 20:41065872-41065894 CTACTCCTAGGTATACACCCCGG - Intronic
1177527961 21:22321496-22321518 CTCTTCCTAAGGATGTTCCTTGG - Intergenic
1184793532 22:46717269-46717291 CCATTCCCAGGTATGCACCCAGG + Intronic
1184932197 22:47689761-47689783 CCACTCCTAGGCATGTACCTAGG - Intergenic
1185276983 22:49954036-49954058 CTGTTCCTAGGAGTGTCCCCAGG - Intergenic
951126324 3:18988603-18988625 ATGTTCCTAGGGCTGTAACCTGG - Intergenic
952363045 3:32650055-32650077 CTACACCTAGGTATATACCCAGG - Intergenic
952550802 3:34474492-34474514 CTACTCCTAAGTATTTACCCAGG - Intergenic
953469745 3:43156513-43156535 CTATTCTCAGGCATGAACCCAGG + Intergenic
953470332 3:43160883-43160905 CTATACCTAGTGATGTTACCAGG + Intergenic
958013208 3:87907037-87907059 CCACTCCTAGGTATCTACCCAGG - Intergenic
958030374 3:88101676-88101698 CTATGCCTAGGTATCTACCTAGG - Intronic
961175388 3:124831063-124831085 CTATTCCAGGGGATGTACTAGGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962730801 3:138281766-138281788 CTATTCTGAGGGATCTTCCCTGG + Intronic
963337603 3:143994613-143994635 CTATCTCTAGGGATCTACCTCGG + Intronic
966520307 3:180867586-180867608 CTAATCCTAGGTATATACTCAGG + Intronic
968322069 3:197778889-197778911 CTACTCCTAGGTATTTACCAGGG - Intronic
968601206 4:1510408-1510430 CCACTCCTAGGCATTTACCCAGG - Intergenic
969352814 4:6607733-6607755 CTACTCCTAGCTATGTACCCAGG - Intronic
972712230 4:41609015-41609037 AAATTCCTAGTAATGTACCCTGG + Intronic
977259365 4:94780521-94780543 CCACTCCTAGGTATATACCCAGG - Intronic
978896479 4:113894524-113894546 TCATTCCTAGGAATATACCCTGG - Intergenic
981134097 4:141190431-141190453 CAGTTCCTAGGGATGTCCTCAGG - Intronic
985017801 4:185655443-185655465 CTATACATGGGGATGTACTCTGG + Intronic
985575380 5:671280-671302 CTCTTCCTAGTGATGTCCACAGG - Intronic
987187442 5:15439157-15439179 CTATTCCCGGGTATGTATCCTGG + Intergenic
988578594 5:32449450-32449472 CCACTCCTAGGGATATACTCAGG - Intergenic
989403248 5:41032078-41032100 CCATTCCTTGGTATATACCCAGG - Intronic
991645638 5:68798207-68798229 CTAATCCTAGGTATTTACCCTGG + Intergenic
992310710 5:75496461-75496483 CCATTCATAGGTATCTACCCAGG + Intronic
993003749 5:82408893-82408915 ACAATCCTAGGTATGTACCCAGG - Intergenic
993498687 5:88638892-88638914 CCACTCCTAGGTATTTACCCAGG + Intergenic
993692569 5:91020515-91020537 CATTTCCTAGTGATGTAACCTGG - Intronic
994469202 5:100181032-100181054 CTACTCCTAGGTATATATCCAGG - Intergenic
996620097 5:125490016-125490038 CCACTCCTAGGAATTTACCCAGG - Intergenic
997614403 5:135236679-135236701 CTTTTCCTAGGGGTCTACCTTGG + Intronic
998210911 5:140197403-140197425 CCTTTCCTATGGATATACCCAGG + Intronic
998273678 5:140731174-140731196 TGACTCCTAGGTATGTACCCTGG - Intergenic
998585778 5:143425864-143425886 CAACTCCTAGGAATTTACCCAGG + Intronic
999007117 5:147994918-147994940 CTATTCCTAGGTGTTTACCCAGG - Intergenic
1000945320 5:167415811-167415833 ATATTACTAGAGATGTACCACGG - Intronic
1003661074 6:8062845-8062867 TCATGCCTAGGTATGTACCCTGG + Intronic
1004968795 6:20885298-20885320 CTATTCCTATGCAAGTACCATGG - Intronic
1007356160 6:41319320-41319342 CTATTCCTGGGGATTCAACCTGG - Intergenic
1013314403 6:108927227-108927249 CTCTTCCTAGTGAAGTGCCCAGG - Intronic
1015614229 6:135058277-135058299 CTACTCCTAGGTATTTACCCAGG - Intronic
1018184574 6:161255359-161255381 CTACTCCTAGGAATCTACTCAGG + Intronic
1030008082 7:105138015-105138037 CAAATTCTAGGGATGTACCAGGG - Intronic
1030112716 7:106040327-106040349 CCATTCCTAGGTATATACCTAGG - Intergenic
1030928093 7:115482326-115482348 CCATTTCTAGGGAAGTCCCCAGG - Intergenic
1031501089 7:122517403-122517425 CCACTCCTAGGTATTTACCCAGG - Intronic
1032549256 7:132769330-132769352 CTATACCTAGGAATATACCCAGG - Intergenic
1033382957 7:140841380-140841402 CTATTCCTAGGCATACAGCCAGG + Intronic
1033879040 7:145858963-145858985 CTATACCTAGGGATGGATCCAGG - Intergenic
1034138422 7:148793756-148793778 CTATACCTAGGTATATACCCAGG - Intronic
1035176095 7:157052111-157052133 CCACTCCTAGGTATATACCCAGG + Intergenic
1037568594 8:20139461-20139483 TTACTCCTAGGTATATACCCAGG + Intergenic
1039018387 8:33178779-33178801 CTATTCATAGAGATGTATCTAGG + Intergenic
1040358018 8:46638437-46638459 ATATTCCTAGGGAAGCACCTAGG + Intergenic
1053066796 9:35074778-35074800 ATATACCTAGGGATATATCCAGG - Intronic
1057012980 9:91622975-91622997 CTATTCCTAGGTATAAACCCAGG - Intronic
1057603278 9:96478480-96478502 CCACTCCTAGGTATTTACCCAGG - Intronic
1057714124 9:97476060-97476082 CCATTCCTATGTATGTACCCTGG - Intronic
1060743949 9:126117717-126117739 CTGTTCCGAGGGATGCACCCGGG + Intergenic
1187167018 X:16813725-16813747 CCACTCCTAGGACTGTACCCTGG + Intronic
1187714403 X:22088311-22088333 CTACTTCTAGGTATTTACCCAGG - Intronic
1187930348 X:24287890-24287912 CCACTCCTAGGTATATACCCAGG - Intergenic
1191764378 X:64681500-64681522 CTGTCCCTAGGGATGGACACAGG + Intergenic
1192100478 X:68259043-68259065 CTATTTCTAAGTATATACCCAGG + Intronic
1192695526 X:73411474-73411496 CTCTTCTTAGGGATTTACTCAGG - Intergenic
1193230456 X:79038770-79038792 CTATTACTGGGTATATACCCAGG - Intergenic
1197338768 X:125240792-125240814 CTACTTCTAGGTATTTACCCTGG + Intergenic
1199823014 X:151469825-151469847 GTATTCCTAGGTACATACCCAGG - Intergenic
1200001293 X:153061700-153061722 CCATTCCTAGGTATTTACTCGGG - Intergenic
1200896598 Y:8382637-8382659 ATATTCCTAGGGAAGCACCTAGG - Intergenic
1202261911 Y:22979028-22979050 GTATTCCTAGGGAAGCACCTAGG + Intronic
1202414899 Y:24612769-24612791 GTATTCCTAGGGAAGCACCTAGG + Intronic
1202455886 Y:25057317-25057339 GTATTCCTAGGGAAGCACCTAGG - Intronic