ID: 910243709

View in Genome Browser
Species Human (GRCh38)
Location 1:85116064-85116086
Sequence CAGCAAGGTGAAATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 11, 3: 25, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910243709 Original CRISPR CAGCAAGGTGAAATGGAGCC AGG (reversed) Intronic
900594549 1:3474776-3474798 CAGCAAGGTAAGATGGGGCCTGG + Exonic
900900907 1:5515229-5515251 GTGGAAGGTAAAATGGAGCCAGG + Intergenic
901627486 1:10632214-10632236 CTCCAGGGAGAAATGGAGCCGGG - Intergenic
902877179 1:19347749-19347771 CAGCAACTTGGAATGGAGCCAGG + Intronic
903673623 1:25051137-25051159 CAGCAAGGTGAGATTGTGGCTGG - Intergenic
904280178 1:29413463-29413485 CAGCAAGTAGAAAGGGAGCCAGG + Intergenic
904916644 1:33975224-33975246 CTGCAAGGTGCAGTGGATCCAGG + Intronic
904953414 1:34262739-34262761 CAGCCAGGTGACCTTGAGCCCGG + Intergenic
905792424 1:40797323-40797345 TAGCTAGGTGAAAAGGAGCAAGG + Intronic
906248179 1:44291785-44291807 CAGCAAGGAGGAGAGGAGCCTGG + Intronic
906799338 1:48722238-48722260 CAGTAAGATGAAATGGAACAGGG + Intronic
907462364 1:54612503-54612525 CAGCCAGCTGAAGTGGGGCCAGG + Exonic
908597932 1:65708587-65708609 TAGCAAGGTGGGATGGGGCCGGG - Intergenic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
910288748 1:85580596-85580618 CACAAAGGTGCAATGGAGCCAGG + Intergenic
910590309 1:88923022-88923044 CAGAACTGTGAAATGGAGCTTGG + Intergenic
910607287 1:89100602-89100624 CAACAAGCTGAGGTGGAGCCTGG - Intergenic
910922349 1:92362419-92362441 CAGAATGGTGAAAAAGAGCCTGG + Intronic
911190399 1:94942870-94942892 CAGCTCGGTGAGAGGGAGCCAGG - Intergenic
912577391 1:110685972-110685994 AAGCAAGGAGAAATGGAGAGAGG - Intergenic
912853075 1:113143821-113143843 CAGTAAGCTGAGATGCAGCCTGG + Intergenic
913349497 1:117842303-117842325 CAGCCAGCTGAAGTGGAGCCTGG + Intergenic
913698111 1:121347572-121347594 CAGCAAGTTGAGATGGGGTCAGG - Intronic
914139439 1:144932480-144932502 CAGCAAGTTGAGATGGGGTCAGG + Intronic
916282840 1:163071779-163071801 CAGCAGAGGGAAATGGAGCATGG - Intronic
917165760 1:172110976-172110998 CAGTAAGCTGAAATTGTGCCAGG + Intronic
917973348 1:180222663-180222685 CAGCTATTTAAAATGGAGCCAGG + Intergenic
918077287 1:181180318-181180340 AAGCAAGGTGAGGAGGAGCCTGG + Intergenic
919115549 1:193276322-193276344 CATCAAGGTGAATGGGAGGCAGG - Intergenic
919159384 1:193808360-193808382 CAGCAATGAGAATTTGAGCCAGG + Intergenic
920485506 1:206366222-206366244 CAGCAAGTTGAGATGGGGTCAGG - Intronic
920952934 1:210589804-210589826 GAGCAAGGTGTGATGGAGCAAGG - Intronic
921091728 1:211849850-211849872 CAAAAAGGTGAAAAGAAGCCAGG - Intergenic
921669984 1:217914572-217914594 CAGCAAAGTGAGATGGAGAAGGG - Intergenic
921958767 1:221012273-221012295 CTGCAGGATAAAATGGAGCCTGG - Intergenic
922179004 1:223219102-223219124 TAGCAAGGAGAAAGGGAGCTGGG + Intergenic
922730016 1:227944931-227944953 CTGCAAGGTGCCAGGGAGCCAGG + Intronic
922904491 1:229163657-229163679 CAGCAAGCTGATATGATGCCAGG + Intergenic
1063212948 10:3897876-3897898 CAGAAATCTGAAATGGAGGCTGG - Intergenic
1063693528 10:8310207-8310229 CAGCAAGTTGCAAAGGAGGCTGG - Intergenic
1065613942 10:27500972-27500994 CAGCCAGGGGCAATGGAGCTGGG + Intergenic
1065775205 10:29113384-29113406 CACCAGGAGGAAATGGAGCCTGG + Intergenic
1066292945 10:34030304-34030326 CAGCAAGGGGAAAAGAGGCCAGG - Intergenic
1066343254 10:34557045-34557067 CAGCAATGTTCAATGGACCCAGG + Intronic
1066556974 10:36625064-36625086 TAGAAAGGAGAAATGGAGGCTGG + Intergenic
1067795550 10:49318877-49318899 CAGCAAGGGGATGTGGAGCCAGG + Intronic
1069711825 10:70494451-70494473 CAGAAAGGTGGACTGGAACCTGG + Intronic
1070589917 10:77794382-77794404 CAGAAAGGCAAAATGGAGCAGGG + Intronic
1071480510 10:86061564-86061586 CAGCAAGGTGAAGCAAAGCCTGG + Intronic
1073071280 10:100794899-100794921 CAACAAGGTGAAATTCAGCAGGG - Intronic
1074546688 10:114406677-114406699 CAGCAAGGAAGAATGGAGCTGGG + Intergenic
1074937876 10:118203889-118203911 CACCAATTTGAAATAGAGCCTGG + Intergenic
1075482586 10:122795465-122795487 CAGCAAGATGAAAGGGAGAACGG + Intergenic
1076483088 10:130797537-130797559 GAGCAAGGTGGAAAGGAGGCCGG + Intergenic
1077529646 11:3089206-3089228 CCCCAGGGTGAAATGCAGCCAGG - Intronic
1081179917 11:39972512-39972534 CAGCAAAGGGAAATGAAACCTGG - Intergenic
1081607231 11:44535125-44535147 CAGCCAGGTGAGATGGTCCCTGG + Intergenic
1081627127 11:44662751-44662773 AAGCCAGGTGGAACGGAGCCAGG - Intergenic
1081652450 11:44833469-44833491 CAGGAAGGAGGAATGAAGCCTGG - Intronic
1082938672 11:58680619-58680641 CAGTAAGGAGAAATGGGACCAGG - Intronic
1083780363 11:64914354-64914376 CTGCAAGGTGAGCTGGAGGCCGG + Exonic
1084480867 11:69419293-69419315 CAGCAGGAAGAAATGGTGCCAGG + Intergenic
1085719061 11:78897291-78897313 CAGCAAAGGGAAAAGAAGCCTGG - Intronic
1086962299 11:92990790-92990812 CAGGAAGGGGAAAAGGAGCATGG + Intergenic
1087375418 11:97333766-97333788 CATCAAGCAGTAATGGAGCCAGG - Intergenic
1087765335 11:102146139-102146161 TAGAAAGGTGATATGGGGCCAGG - Intronic
1091794002 12:3287028-3287050 CATCAAGGTCAAATGAACCCCGG - Intergenic
1092339786 12:7665841-7665863 GAGAAAGGTAAAATGGATCCGGG - Exonic
1092916502 12:13194334-13194356 CTTTAAGGTGAAATGGAGGCAGG + Intergenic
1094001412 12:25698771-25698793 CCTCAAGTTTAAATGGAGCCAGG - Intergenic
1097839753 12:64310300-64310322 CAGAGAGGTGAAGTGGGGCCAGG - Intronic
1098268395 12:68746424-68746446 CAGCAGGTTGAACAGGAGCCCGG - Exonic
1099239301 12:80119391-80119413 CTGCAGGGTGAACTGAAGCCAGG - Intergenic
1103451307 12:121031332-121031354 CAGCCAGGGGAAATGGAAGCAGG - Intronic
1104133562 12:125917154-125917176 CAGGAAGCTGAATTGGAGCTAGG + Intergenic
1104547578 12:129726186-129726208 CAGCAAGGGGAAAAGGTGCATGG - Intronic
1104953659 12:132453632-132453654 CAGGAAGGTGATCAGGAGCCCGG - Intergenic
1105412520 13:20183231-20183253 CAGCAAGATGAAATGTAACAGGG + Intergenic
1105957959 13:25301728-25301750 CAGCAAGGCGAAATGGGTCTGGG - Exonic
1108539281 13:51422631-51422653 CAGCAAGGTGAAAGGTAGACTGG - Intronic
1110932613 13:81241176-81241198 CAGGAAGGTCAAATGGAGAATGG + Intergenic
1111687463 13:91518846-91518868 TAGAAAGCTGAAATTGAGCCGGG - Intronic
1112020061 13:95363756-95363778 GAGAAAGGGGAAATGGAGCTGGG - Intergenic
1112900429 13:104351505-104351527 CAGCAAGTAGAAATGGGGCCAGG - Intergenic
1114732458 14:25007980-25008002 GAGCCAGGTGAAAGTGAGCCAGG - Intronic
1117554941 14:56874528-56874550 CAGAAAGGTGAAATGAATCTGGG + Intergenic
1117643082 14:57821527-57821549 AAGCAAGGTGTTAAGGAGCCTGG + Intronic
1118743880 14:68760265-68760287 CAGCAAAGTAAACTGGAGGCTGG + Intergenic
1118830914 14:69431616-69431638 CAGCATCGTGAAATAGACCCAGG - Intronic
1119548392 14:75490321-75490343 CAGCCAGGAAATATGGAGCCAGG + Intergenic
1120061542 14:79989235-79989257 GAGCAAGGTTAAAGGCAGCCTGG + Intergenic
1121656868 14:95603513-95603535 CACCAATCTCAAATGGAGCCTGG - Intergenic
1121973225 14:98378546-98378568 CTACATGGTGAAAAGGAGCCAGG + Intergenic
1122818804 14:104329703-104329725 ATGCAAAGTGAAATGAAGCCAGG + Intergenic
1124237303 15:28001911-28001933 CAGCTAGGCGACCTGGAGCCTGG + Intronic
1125182086 15:36888748-36888770 CAGCAATTTGATAAGGAGCCTGG - Intergenic
1125600814 15:40915005-40915027 CAGCCAGGCGAGCTGGAGCCAGG - Intergenic
1125635004 15:41180336-41180358 CAGCAAGCTGAGATGAGGCCTGG - Intergenic
1126209852 15:46089515-46089537 TAGGAAGATGAAATGGAGGCTGG - Intergenic
1126336053 15:47587322-47587344 CAGAAATGTAAGATGGAGCCAGG - Intronic
1128316416 15:66662071-66662093 CAGGAATGTGCAATGGTGCCAGG + Intronic
1128521058 15:68375248-68375270 CAGAAAAGGAAAATGGAGCCAGG - Intronic
1129242279 15:74258888-74258910 CAGCAGGGTGTAAGGGGGCCAGG - Intronic
1129900220 15:79142059-79142081 CTGCAAGGTGGAGTGGAACCAGG + Intergenic
1130850155 15:87784822-87784844 CAGAAAGGAGAAAGTGAGCCAGG + Intergenic
1133128407 16:3661813-3661835 CACCCATGTGAAATGGAACCTGG - Exonic
1133767519 16:8848333-8848355 CATCAAGGTGACATGCAGGCGGG - Exonic
1135864149 16:26085138-26085160 CAGCCTGGTGAAATGAAGCCAGG + Intronic
1136027762 16:27480954-27480976 CTGCAAGGCCAAATGCAGCCAGG + Intronic
1137063794 16:35815509-35815531 CAGGAGGGTGAAATGTGGCCTGG + Intergenic
1137232157 16:46576683-46576705 CAGGGAGGGGAAATGAAGCCTGG - Intergenic
1137792827 16:51189135-51189157 CAGCAAGGGGAAGATGAGCCTGG + Intergenic
1138337169 16:56262256-56262278 CAGCAAGTCGCAAGGGAGCCAGG + Intronic
1139587991 16:67916639-67916661 CAGAAAGTGGGAATGGAGCCTGG + Intronic
1140232112 16:73125955-73125977 CAGTAATAAGAAATGGAGCCAGG + Intergenic
1140908145 16:79427749-79427771 CAACTAGGTGTAATGGAGGCTGG - Intergenic
1141248437 16:82332592-82332614 CTGGAAGGTGAAATGGGGACAGG - Intergenic
1143574599 17:7783635-7783657 CAACATGGTGAAAATGAGCCAGG + Intronic
1143875489 17:9987796-9987818 TAACAAGGGGAAATGAAGCCCGG - Intronic
1146465136 17:33080206-33080228 CAGGGAGGTGAAAGGAAGCCAGG + Intronic
1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG + Intronic
1146691178 17:34877227-34877249 CAGAAAGGAGAAAGGGAGACAGG + Intergenic
1146921961 17:36719382-36719404 GAGGAAGGTGAAATGGAAGCAGG - Intergenic
1146969855 17:37063898-37063920 CAGCAGGGTGATGTGCAGCCTGG - Intergenic
1148202922 17:45761827-45761849 CAGCAAGGTGCAGAGGAGGCAGG + Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149575928 17:57713354-57713376 CAGCAAGGAGAAAAGGGGACGGG + Intergenic
1149784217 17:59421803-59421825 CAGGGAGGATAAATGGAGCCAGG + Intergenic
1151756682 17:76079281-76079303 CAGGAAGGTGAGATGGAGCAGGG - Exonic
1152042971 17:77917027-77917049 CATAAAGGTGAAATACAGCCAGG + Intergenic
1152747544 17:82048385-82048407 CAGCAACAGGTAATGGAGCCCGG + Exonic
1153678145 18:7474112-7474134 CAGAAACCTGAAAAGGAGCCAGG - Intergenic
1153910359 18:9701426-9701448 CATTTAGGAGAAATGGAGCCAGG + Intergenic
1154206621 18:12342837-12342859 CAGTGGGGTGGAATGGAGCCCGG - Intronic
1155044305 18:22090130-22090152 CAGCAAATTGAGAGGGAGCCAGG + Intronic
1155054070 18:22170076-22170098 GAGGGAGGTGAAATGCAGCCGGG - Intronic
1155829396 18:30493670-30493692 AATCAAGATGAAAGGGAGCCAGG - Intergenic
1156549627 18:38001927-38001949 CAATAAGCTGAAATAGAGCCCGG - Intergenic
1157923144 18:51734251-51734273 CTGCTAGGTGGAATGGAGTCTGG + Intergenic
1160695138 19:480235-480257 GAGCAAGGAGAAGAGGAGCCGGG + Intergenic
1161860588 19:6795226-6795248 GAGCAGGGTGCAAAGGAGCCTGG + Intronic
1163327862 19:16616832-16616854 CAGCAAGGGGCAAGGGAACCAGG + Intronic
1165395836 19:35563193-35563215 CACCAAGGTGAGCTGGAGACTGG - Exonic
926045985 2:9709953-9709975 CAGCTAGCTGCAAGGGAGCCTGG - Intergenic
926344201 2:11930704-11930726 CAGCATGGTCACATGAAGCCTGG - Intergenic
927489966 2:23514796-23514818 CAGCAAGGATAGATGGAGCGTGG - Intronic
929200887 2:39234453-39234475 CAGAAAGTTGAAATGGAGACAGG + Intergenic
929283930 2:40114620-40114642 CATAAAAGTGGAATGGAGCCAGG - Intronic
929883710 2:45860159-45860181 CAGCAAGCTGGAATAGTGCCTGG + Intronic
929938355 2:46311363-46311385 CAGTTAGGTGGAAAGGAGCCTGG + Intronic
932525213 2:72458853-72458875 CAGCATGATGAAATGGGGACAGG + Intronic
933108036 2:78358119-78358141 CAGCAAGATGAAATGTGACCAGG - Intergenic
934659708 2:96136760-96136782 AAGCCAGTTGAAATGGAGACTGG - Intronic
935549483 2:104437294-104437316 GAGCTAGGTGATGTGGAGCCAGG - Intergenic
935628074 2:105187513-105187535 CTGCAGGCTGAAATGAAGCCGGG + Intergenic
935702679 2:105825916-105825938 CATCAAGATCTAATGGAGCCAGG - Intronic
936819039 2:116496641-116496663 CAGCAAGGGGAAAAGGTGCATGG - Intergenic
937032559 2:118752868-118752890 CAGCAAGGTTTAAGGAAGCCAGG + Intergenic
938830365 2:135044293-135044315 CAAAAAGATGTAATGGAGCCAGG + Intronic
939684520 2:145182260-145182282 CAGCAAGGTCTGATAGAGCCAGG + Intergenic
939855294 2:147351962-147351984 CAGCAACTTGAAATGCAGTCTGG + Intergenic
940037675 2:149328413-149328435 GAGGAAGTTCAAATGGAGCCTGG - Intergenic
941516412 2:166485849-166485871 GAGCAAGTTGTAAAGGAGCCAGG + Intronic
944491024 2:200257963-200257985 CAGAAAGGTGAAAGGCAGTCGGG + Intergenic
945098671 2:206243374-206243396 GAGTAAGGTGAAATGAAGACAGG + Intergenic
945393206 2:209290083-209290105 CAGCAAGGAGAAATAGTACCTGG - Intergenic
947763316 2:232619733-232619755 CAAAATGGTGAATTGGAGCCTGG + Intronic
947878789 2:233486605-233486627 CAGCAAGGGGAAATGAAGACTGG + Intronic
948079686 2:235195637-235195659 CAGAATGGTGGGATGGAGCCAGG - Intergenic
948513813 2:238490308-238490330 CAGCAAGGGGAAAAGGTGCATGG + Intergenic
948747933 2:240109409-240109431 CAGCAAGGAGAAAAAGAACCGGG - Intergenic
1169824307 20:9749858-9749880 CAGCAAGGAGATATGGAACTTGG - Intronic
1169835160 20:9869818-9869840 CAGCTAGCTGAAAGGGAGGCTGG + Intergenic
1169989228 20:11482058-11482080 CTGAAAGGTAAGATGGAGCCAGG + Intergenic
1174123254 20:48283322-48283344 GGGGAAGGTGAAAGGGAGCCGGG + Intergenic
1174171378 20:48620052-48620074 CAGCATGGGGAACTGGAGCCTGG + Intergenic
1175277703 20:57783287-57783309 CAGCAAGGGGCAAGGGAGCCAGG + Intergenic
1175319133 20:58073108-58073130 CAAAGAGGTGACATGGAGCCAGG - Intergenic
1175681575 20:60992923-60992945 CAGCAGGGTGAAAAAGAGGCAGG + Intergenic
1177416931 21:20806181-20806203 CAGAAAGGTGAAATGGAGTCAGG - Intergenic
1181949589 22:26544469-26544491 CAGAAAGGTGAAAACCAGCCAGG + Intronic
1182520987 22:30884501-30884523 CAGAGATGTGAAATGGGGCCTGG - Intronic
1185047173 22:48534360-48534382 CAGGCAGGTGAGATGGGGCCGGG + Intronic
949625499 3:5862080-5862102 AAGCAAGGTGTTAGGGAGCCTGG - Intergenic
950896474 3:16456184-16456206 CAGGAAGGAGGAATGCAGCCGGG + Intronic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
952580242 3:34824486-34824508 CAGCAAGAGGAAATGGAGTTTGG + Intergenic
952911688 3:38194572-38194594 TAGCCAGGTGAAATGGAGGCTGG + Intronic
953719561 3:45343561-45343583 CAGAAAGGTAAATTGGGGCCAGG + Intergenic
955227151 3:57070099-57070121 AAACAAGATAAAATGGAGCCTGG + Intronic
956080107 3:65548932-65548954 CAGCAAGGGGGAAGGGAACCTGG + Intronic
961149145 3:124621635-124621657 CAGCAACAGGAAATGGGGCCGGG - Intronic
961710572 3:128824945-128824967 CAGCAAGGAGAATGGGGGCCTGG - Intergenic
961999979 3:131285587-131285609 CAGAAAACTGAAATGGAGCTGGG - Intronic
965137259 3:164787220-164787242 CTGCAAGGTGAAAGTGAGGCTGG + Intergenic
967290176 3:187911895-187911917 CAGTAAATTGAAATGGAGGCAGG + Intergenic
967379261 3:188839514-188839536 CAGCAAGGTGATAAGGCGCAGGG + Intronic
967654427 3:192029923-192029945 CAGCAAAGTGAAATGGACAGAGG - Intergenic
968935486 4:3608006-3608028 CAGCAAGGTCAGATGGCCCCTGG - Intergenic
969097011 4:4741128-4741150 CATTAAGCTGACATGGAGCCTGG - Intergenic
969136594 4:5034134-5034156 CAGCTAGGTGAAATGGAGTTAGG - Intergenic
969711858 4:8849285-8849307 AAGCAAGCTGAAATGCAGGCAGG + Intronic
975153498 4:71045501-71045523 CAGTGAGGAGAAATGGATCCAGG - Intergenic
976100574 4:81558489-81558511 CCGCATGGTGAAAGGGAGCATGG + Intronic
976326633 4:83779240-83779262 AAGGGAGGGGAAATGGAGCCAGG - Intergenic
976510315 4:85901262-85901284 CAGCAAGTTAAAATGAAGGCAGG - Intronic
976619605 4:87114715-87114737 CTGCAGGGGGAAAGGGAGCCAGG + Exonic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977894260 4:102345767-102345789 CAACTTGCTGAAATGGAGCCTGG + Intronic
979032267 4:115665231-115665253 CAGGAAAGTGACATGTAGCCTGG - Intergenic
980417388 4:132509548-132509570 TAACATGGTAAAATGGAGCCTGG + Intergenic
987069344 5:14321321-14321343 CAGCAAGGTAACATGGGGTCAGG + Intronic
987590597 5:19920805-19920827 AAGTAAGGTTAAATGGGGCCGGG - Intronic
987698639 5:21365916-21365938 CAGCAAGGTGAAATGGATCAAGG + Intergenic
987862508 5:23506317-23506339 CTGCAAGGAGATACGGAGCCTGG - Intergenic
988183342 5:27827288-27827310 ATGCAAGGTGAAATGGAGAGGGG - Intergenic
988754014 5:34225614-34225636 CAGCAAGGTGAAATGGATCAAGG - Intergenic
990943915 5:61230371-61230393 CAGCAGGGTGACATTAAGCCAGG + Intergenic
991547534 5:67800096-67800118 CATCAAGGTCAACTGGAGACTGG + Intergenic
991741795 5:69686457-69686479 CAGCAAGGTGAAATGGATCAAGG - Intergenic
991755897 5:69868751-69868773 CAGCAAGGTGAAATGGATCAAGG + Intergenic
991793369 5:70266196-70266218 CAGCAAGGTGAAATGGATCAAGG - Intergenic
991821179 5:70561762-70561784 CAGCAAGGTGAAATGGATCAAGG - Intergenic
991835225 5:70743899-70743921 CAGCAAGGTGAAATGGATCAAGG + Intergenic
991885744 5:71265731-71265753 CAGCAAGGTGAAATGGATCAAGG - Intergenic
992003127 5:72454310-72454332 CTGCAAGGTGCTATGGAACCTGG - Intronic
992786330 5:80173793-80173815 CAGAAAGGTGAAAAGGTGTCAGG - Intronic
995294840 5:110507596-110507618 CAGCAAGGTGATATGGCCCATGG - Intronic
995307124 5:110665606-110665628 CAGCAAGGGGAAATCCATCCCGG + Intronic
995603711 5:113827680-113827702 CAGTGAGGTGAAATGGATACAGG - Intergenic
995694632 5:114865688-114865710 GAGCAAGGTGGAAGGGAGACCGG - Intergenic
998654606 5:144162893-144162915 GAGCAAGGGGAAAGGAAGCCAGG + Intronic
999283201 5:150378547-150378569 CACCTAGCTGAAAGGGAGCCTGG + Intronic
999593209 5:153171912-153171934 CAGGGAACTGAAATGGAGCCTGG + Intergenic
1001133238 5:169081266-169081288 CAGCAGGGTGGGAAGGAGCCTGG + Intronic
1001930950 5:175672675-175672697 GAGCAAGGTGGAGTGGATCCTGG + Intronic
1001962757 5:175890083-175890105 GATCAAGGTCAAATGAAGCCTGG - Intergenic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1004340046 6:14800056-14800078 CACCAAGCTGCAAGGGAGCCTGG - Intergenic
1005100940 6:22172072-22172094 CTGCAAGGTGAAAGCGAGGCTGG - Intergenic
1005552195 6:26932454-26932476 CAGCAAGGTGAAATGGATCAAGG - Intergenic
1007138299 6:39544438-39544460 AAGCAATGTGAAATGGAAGCTGG + Intronic
1007599908 6:43075367-43075389 CAGCCAGGAGAAGTGGCGCCAGG - Intergenic
1007787779 6:44291087-44291109 CAGCCATGTGATATGGAGCGAGG - Intronic
1008042527 6:46816881-46816903 CAGGAAGGTGAGCAGGAGCCTGG + Intronic
1010455286 6:76047608-76047630 CACCAAGGTGAACTGGAGAGGGG - Intronic
1011768690 6:90652224-90652246 CAGCAAGGTCAGGTTGAGCCAGG - Intergenic
1012996814 6:105982747-105982769 AAGCCAGGTGACAGGGAGCCAGG + Intergenic
1013732564 6:113185629-113185651 CAGCAAGGTGAAAAGCTTCCAGG - Intergenic
1014021213 6:116592301-116592323 CACCAAGAAGAAAAGGAGCCAGG - Intronic
1015012733 6:128371712-128371734 AAGCAAGGCCAAATGCAGCCAGG + Intronic
1015325433 6:131918594-131918616 AAGCAAGCTGATGTGGAGCCAGG + Intergenic
1015335299 6:132030277-132030299 CATAAAAGTGAAATGCAGCCAGG + Intergenic
1016882924 6:148928849-148928871 CAACAAGGTGAACTTGAGCTGGG - Intronic
1017964708 6:159254058-159254080 AAGCCAGGTGAACTGGACCCTGG - Intronic
1018528983 6:164742918-164742940 AAGAAAGGTAGAATGGAGCCAGG + Intergenic
1020228483 7:6298716-6298738 CAGTGAGCTGAGATGGAGCCTGG - Intergenic
1021507892 7:21405369-21405391 CAGCATGTGGAAATGGACCCAGG - Intergenic
1022327612 7:29346170-29346192 CAGCACGGCCAAATGGTGCCAGG - Intronic
1022405350 7:30084879-30084901 CAGCTAGGAGGAATAGAGCCAGG + Intronic
1023664915 7:42513062-42513084 CAGCAAGGTCAAAGGGAAGCAGG - Intergenic
1024226092 7:47327876-47327898 CAGCAAGGGCAACTGGATCCGGG + Intronic
1024773022 7:52747175-52747197 CAGCTAGGAGAAATTGAGCCTGG + Intergenic
1027122805 7:75534041-75534063 GACCAGGGTCAAATGGAGCCAGG + Exonic
1027425533 7:78058273-78058295 CAGGAAGGTGACACAGAGCCTGG + Intronic
1028833761 7:95351824-95351846 CAGCAAGGTCCAAGGGAGACAGG - Intergenic
1029421116 7:100472353-100472375 CAGCAGGGTGAAGTGGAGGCTGG + Intronic
1030438216 7:109552324-109552346 CAGCAAGGAAGAATGGATCCAGG - Intergenic
1031280741 7:119796911-119796933 CTGCAAAGTGAAATGGTGCTGGG - Intergenic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1034345061 7:150380951-150380973 AAGCAAAGTGAGATGGAGCAGGG - Intronic
1034483461 7:151341465-151341487 CATCAAGAGGAAATGGATCCTGG - Intergenic
1035104709 7:156432548-156432570 CAGCAAGGTGCTACGGACCCCGG - Intergenic
1035738159 8:1904203-1904225 CATCAAGCTGAAATGTAGCCTGG - Intronic
1036212736 8:6855300-6855322 CAGCATTGTGAGATGGAGCATGG - Intergenic
1036642354 8:10592345-10592367 AAGAAAGGTAAAATGGAGCCAGG + Intergenic
1037466744 8:19168455-19168477 CAGCTATGTGATCTGGAGCCTGG - Intergenic
1039907951 8:41799817-41799839 CACCCAGGTGAAAGGGAGCTGGG + Intronic
1040011360 8:42663809-42663831 CAGGGAGATGAAATAGAGCCTGG - Intergenic
1041271003 8:56109068-56109090 CATCAAGGAGAATGGGAGCCAGG - Intergenic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1045974193 8:108112890-108112912 CAGCAAAGTGAAATGGAATTTGG + Intergenic
1049183063 8:141233036-141233058 CACCAAGGCGAAAGGGAGTCGGG + Intronic
1049442727 8:142616645-142616667 CAGCAAGCTGACAAGGAGGCAGG + Intergenic
1051000313 9:12273948-12273970 CAGCAAGGTGCAGTGGAGTCTGG + Intergenic
1051436852 9:17042759-17042781 GACCTATGTGAAATGGAGCCAGG - Intergenic
1051885700 9:21890342-21890364 CAGCAAGGAGACATGTAGCCTGG - Intronic
1051971666 9:22895267-22895289 CGGCAAGTTGAAATGAAGCTGGG + Intergenic
1052683976 9:31730874-31730896 GAGCAAGGTGAAATGATGGCAGG + Intergenic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1055362730 9:75511568-75511590 CAACAAGGTGAAAGGGAGCAAGG - Intergenic
1055487497 9:76771484-76771506 CAGCAATGTGACATGAAGGCAGG + Intronic
1055813251 9:80176870-80176892 GAGGAAGGTGAAATGGAAGCAGG + Intergenic
1056568773 9:87797985-87798007 AGGCAAGGTGACCTGGAGCCAGG - Intergenic
1056680377 9:88712578-88712600 CAGCTAGGAGAAATGAAGGCAGG + Intergenic
1057288053 9:93776886-93776908 GAGCATGGTGAAAAGCAGCCAGG + Intergenic
1060995653 9:127873817-127873839 CAGCAAGGTGGGATACAGCCTGG - Intronic
1061203001 9:129148048-129148070 GGGCAGGGTGAAAAGGAGCCTGG - Exonic
1061210203 9:129187258-129187280 CAGCTAGCTGCAAGGGAGCCTGG + Intergenic
1061277993 9:129580516-129580538 CAGCAAGAGGAAATGGATGCAGG - Intergenic
1061385566 9:130287375-130287397 TAGGAAGGTGAGAAGGAGCCAGG - Intronic
1186754018 X:12650888-12650910 CAGCAAGTTGACATTCAGCCTGG + Intronic
1188826709 X:34844039-34844061 TAGCAAGGTGAATTGGAAGCAGG + Intergenic
1189284865 X:39844857-39844879 CAGCAAGGTAAAAAGGAGCTGGG + Intergenic
1189626611 X:42903801-42903823 CAGCAAGATGAAGTTGAGCTAGG - Intergenic
1190178552 X:48171572-48171594 AAGGAAGGTGAAATGGAGAAAGG + Intergenic
1190192619 X:48290384-48290406 AAGGAAGGTGAAATGGAGAAAGG - Intergenic
1190198591 X:48341372-48341394 AAGGAAAGTGAAATGGAGACAGG - Intergenic
1190665360 X:52691783-52691805 AAGGAAAGTGAAATGGAGACAGG - Intronic
1190674062 X:52766636-52766658 AAGGAAAGTGAAATGGAGACAGG + Intronic
1191612175 X:63129010-63129032 CACCAAGGTGAGCTGAAGCCAGG - Intergenic
1191624122 X:63249916-63249938 CACCAAGGTGAGCTGAAGCCAGG + Intergenic
1192370350 X:70507755-70507777 GAGCAAAGTGAGATGCAGCCTGG - Intergenic
1192620283 X:72672356-72672378 CAGCATGATGAACGGGAGCCAGG - Intronic
1193642031 X:84021187-84021209 CAGTAAGGTGAAATTAAGACAGG + Intergenic
1193758782 X:85440531-85440553 CAGCAAGGAGGAATGGATCTGGG + Intergenic
1195969210 X:110455695-110455717 CTGCCAGGTGAAATAGAACCAGG - Exonic
1197708133 X:129648367-129648389 CAGCAGGGTGGAAGGGAGACTGG + Intronic
1199982647 X:152929294-152929316 CAGCCAGGTGACATGCAGGCAGG + Intronic