ID: 910251321

View in Genome Browser
Species Human (GRCh38)
Location 1:85201343-85201365
Sequence CCCGGGGCGCGGGTCCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910251321_910251330 -2 Left 910251321 1:85201343-85201365 CCTCCGGGGACCCGCGCCCCGGG 0: 1
1: 0
2: 2
3: 46
4: 291
Right 910251330 1:85201364-85201386 GGACCCCACGCCTCAGGTGACGG 0: 1
1: 0
2: 0
3: 7
4: 115
910251321_910251335 4 Left 910251321 1:85201343-85201365 CCTCCGGGGACCCGCGCCCCGGG 0: 1
1: 0
2: 2
3: 46
4: 291
Right 910251335 1:85201370-85201392 CACGCCTCAGGTGACGGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 41
910251321_910251337 14 Left 910251321 1:85201343-85201365 CCTCCGGGGACCCGCGCCCCGGG 0: 1
1: 0
2: 2
3: 46
4: 291
Right 910251337 1:85201380-85201402 GTGACGGCGAGGGCTGCTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 122
910251321_910251326 -8 Left 910251321 1:85201343-85201365 CCTCCGGGGACCCGCGCCCCGGG 0: 1
1: 0
2: 2
3: 46
4: 291
Right 910251326 1:85201358-85201380 GCCCCGGGACCCCACGCCTCAGG 0: 1
1: 0
2: 4
3: 28
4: 245
910251321_910251334 3 Left 910251321 1:85201343-85201365 CCTCCGGGGACCCGCGCCCCGGG 0: 1
1: 0
2: 2
3: 46
4: 291
Right 910251334 1:85201369-85201391 CCACGCCTCAGGTGACGGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910251321 Original CRISPR CCCGGGGCGCGGGTCCCCGG AGG (reversed) Intergenic
900100783 1:961136-961158 TCCGGGGCGGGGGTCCTTGGCGG + Intronic
900113835 1:1020418-1020440 CCTGGGGCGGGGGTCCCGGCGGG - Intronic
900289628 1:1918470-1918492 CCCAGGGTGCAGGTGCCCGGTGG - Intronic
900294546 1:1942464-1942486 CCCTGGGTGCGGGGCCCTGGAGG + Intronic
900394543 1:2447804-2447826 CCCGGTCGGCTGGTCCCCGGTGG - Intronic
900512719 1:3068162-3068184 CCAGTGGCCCGGGTCCCCGAAGG + Intergenic
900512931 1:3068901-3068923 TCCGGGGTGCGGGCCCCGGGCGG + Intergenic
900985079 1:6068632-6068654 CCCGGGGCGGGGGTGCCCGATGG - Intronic
901332766 1:8423724-8423746 CGCGCGGCGCGGGGCCCGGGGGG + Intronic
901489326 1:9588799-9588821 CCGGGGGCGCGGGCCGCAGGCGG - Intergenic
903078021 1:20787057-20787079 CGGGGCGCCCGGGTCCCCGGAGG - Intronic
903153294 1:21428255-21428277 CGCGGGGCGCGGGGCCTGGGAGG - Intergenic
903219985 1:21864184-21864206 CCCGGTGCGCGTGTAGCCGGGGG + Exonic
904751100 1:32741866-32741888 CTCCGGGCGCGCGTCCCCGGCGG + Exonic
904942883 1:34177303-34177325 CTCGGGGGGCGGGGCCCCGCAGG - Intronic
906263144 1:44407846-44407868 CCCGGGGCGGGGCTGCTCGGGGG + Intronic
906321501 1:44820300-44820322 CACGGGGTGCGGGTCCCAGGAGG - Intronic
906532840 1:46533254-46533276 CACGGGGCGCGAGGCCCCGGCGG + Intergenic
907341558 1:53739206-53739228 CCTGCGGGGCGGTTCCCCGGGGG + Intergenic
910251321 1:85201343-85201365 CCCGGGGCGCGGGTCCCCGGAGG - Intergenic
910408498 1:86914978-86915000 GGCGGGGAGCGGGACCCCGGAGG - Exonic
912381431 1:109249969-109249991 GCCAGGGCGCCAGTCCCCGGGGG - Intergenic
913714438 1:121519502-121519524 CGCGAGGCTCGGGTCCCCGCGGG + Intergenic
915333495 1:155127784-155127806 CCCGGCGCGCGGCTGCCTGGGGG - Exonic
917944559 1:179955204-179955226 CCGCGGTCCCGGGTCCCCGGTGG + Intronic
917981327 1:180271558-180271580 CCCGGGCCTGGGATCCCCGGAGG - Intronic
918282843 1:183023191-183023213 CCCGCGGCGCGCGACCCGGGGGG - Intergenic
922925129 1:229342159-229342181 GCGGGCGCGCGGGGCCCCGGAGG - Exonic
923007884 1:230066977-230066999 GCCGGGGCGCGGGCCGCGGGAGG - Intronic
1062874162 10:931736-931758 CGCGAGGCGCGGGTCCGCGCGGG - Intergenic
1062874453 10:932530-932552 GCCGGGGCCTGGGTCCCCGGTGG - Intergenic
1062874491 10:932612-932634 GCCGGGGCCTGGGTCCCGGGTGG - Intergenic
1062890476 10:1056480-1056502 CCCGGGGCGCGGTCCGCCTGAGG - Intronic
1063452935 10:6163641-6163663 CCCGGGGCCCGGGACCCAGCTGG - Intronic
1064028916 10:11870331-11870353 CGCGGGCCGCGGCTCCTCGGAGG + Exonic
1064209000 10:13347873-13347895 GGCGGCGCGCGGCTCCCCGGCGG + Intronic
1064662112 10:17617067-17617089 CCCGCGGCGCGCGTACCCCGCGG + Exonic
1064860323 10:19817949-19817971 CCCGGGGCGCAACTCCCCGCAGG - Intronic
1065020007 10:21495912-21495934 TCCGGGGCCCCGGTCCCCGGAGG + Exonic
1066220801 10:33335312-33335334 CCCGGGGCCCGCGCCCTCGGCGG + Intronic
1066987041 10:42476460-42476482 CCCGGGGGGTGGGACCCCAGGGG - Intergenic
1067694370 10:48524256-48524278 CCCGCTGCGCGGGGCCGCGGTGG - Intronic
1069438548 10:68407336-68407358 CCCGGGGCGCCGCTCCCCCTGGG - Intergenic
1070767910 10:79067192-79067214 GCCGGGGGGCGGGCACCCGGAGG - Intergenic
1074169741 10:110920017-110920039 CGCGGGCCGGGGGCCCCCGGCGG + Intronic
1074522617 10:114239446-114239468 CCCGGGGCGCGGCTGCCACGTGG - Exonic
1074618305 10:115092937-115092959 CCCGGGGCGCGGGGTGCGGGTGG + Intergenic
1075768950 10:124917266-124917288 CCCGGGGCCCGGTTACCTGGCGG - Intergenic
1076706887 10:132307315-132307337 CTCGGGGCGAGGGTCCCCCGCGG - Intronic
1076792859 10:132786055-132786077 CGCGGGGCGCGGGGCGCGGGGGG + Intergenic
1076818678 10:132927301-132927323 CCCGGGGAGCAGGTCCTCGGCGG + Intronic
1076818689 10:132927337-132927359 CCCGGGGAGCAGGTCCTCGGCGG + Intronic
1076818700 10:132927373-132927395 CCCGGGGAGCAGGTCCTCGGCGG + Intronic
1076818711 10:132927409-132927431 CCCGGGGAGCAGGTCCTCGGCGG + Intronic
1077224348 11:1433607-1433629 CCCGGGGCAGGGGTCCCTGCAGG - Intronic
1077281882 11:1749572-1749594 CCAGGGGCGGGGGTCCCTGGAGG - Intronic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1077480610 11:2812752-2812774 CCGGGGGCGTGGGGCCTCGGGGG - Intronic
1083656847 11:64234165-64234187 CCCGGGGCGCCGGCCCCTGAGGG + Exonic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084128725 11:67118314-67118336 TCCTGGGCTCGGCTCCCCGGGGG - Intergenic
1084171277 11:67401979-67402001 CCCGGGGGGCGGGGCCTCGGCGG + Intronic
1089533940 11:119149456-119149478 CCCGGGGCACGCGGGCCCGGGGG + Intronic
1090799137 11:130159886-130159908 CGCGGGGCGCGGGGCGCAGGCGG - Exonic
1091330512 11:134728048-134728070 CCAGGGGGGCAGGTCCCAGGAGG + Intergenic
1091434143 12:460295-460317 CCCTGGGCGCGGGGCCCGGCCGG + Intergenic
1092219122 12:6700756-6700778 CCTGGGGCGCGGGGCGGCGGCGG + Intronic
1093435477 12:19130211-19130233 CCCGCGCCGCGGGCCCCGGGAGG + Intronic
1095937985 12:47705763-47705785 CTCGGGTCGCGCGTTCCCGGAGG - Intronic
1096121093 12:49089932-49089954 CTAGGGGCGCTGCTCCCCGGCGG - Exonic
1101371760 12:104137690-104137712 GCGGCGGCGCGAGTCCCCGGGGG - Intronic
1101877066 12:108603188-108603210 ACCAGGGCGGGGGACCCCGGCGG - Intergenic
1103507600 12:121452511-121452533 CTCAGGGCGCTGCTCCCCGGGGG - Intronic
1103889560 12:124228320-124228342 CACGGGTGGCAGGTCCCCGGGGG + Intronic
1104021266 12:124993887-124993909 CAGGGGGCGCGGGGCCGCGGCGG + Exonic
1104901071 12:132189802-132189824 CACTGCGCGCGGGTCCCAGGCGG + Intergenic
1106555155 13:30803104-30803126 CCCAGGGCGCGGGAGCCCGCAGG - Intergenic
1106776915 13:33017220-33017242 CCCGCGGCTCGGGTACCTGGTGG + Exonic
1108577774 13:51804157-51804179 CCCGGGGGGCGGGACCAGGGCGG - Intronic
1110219620 13:73059357-73059379 GCTGGGGCACGGGTCCCAGGCGG - Exonic
1112291094 13:98143966-98143988 CGCGGCGCGAGGGTTCCCGGCGG + Intronic
1112374461 13:98825827-98825849 CCAGGGCAGGGGGTCCCCGGGGG + Intronic
1112503020 13:99956749-99956771 CCCGCGGCCCGGGTCCCAGCGGG - Intergenic
1113536139 13:111067542-111067564 GCAGGTGCGCGGCTCCCCGGCGG + Intergenic
1113790030 13:113023372-113023394 CCCGGGACGCTGGGCCCCCGAGG - Intronic
1113805694 13:113109192-113109214 CCAGGGGCGTGGGTGTCCGGGGG + Intronic
1113820416 13:113209191-113209213 CCCGGGGCGCGCGCCTCCTGAGG - Intronic
1115331349 14:32201771-32201793 CCCGGGGCCTGGGTCCCACGCGG + Intergenic
1117157092 14:52951439-52951461 CCCGGGGCGCTGGTGGCCGGCGG + Intronic
1118610206 14:67533586-67533608 CTCGCGGCGCGAGTCCCCTGGGG - Intronic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1119004124 14:70908310-70908332 CCACGGGCGGGGGGCCCCGGCGG - Intronic
1121595364 14:95157757-95157779 CTCGGCGCGCGGGTTCCCGGGGG - Intronic
1122558355 14:102593202-102593224 CGCGGGGCCCGGGGCCGCGGGGG - Intronic
1122719941 14:103716192-103716214 CCCGGTGCGGGGGTCCCGGGAGG + Intronic
1122865937 14:104603987-104604009 CCCGGGGCGATGGTGCCGGGTGG + Intronic
1122960974 14:105093518-105093540 CCCGGGGCGCGGGCCGGGGGCGG - Intergenic
1124696756 15:31870334-31870356 GCCGGGGCGCGGGGACGCGGGGG - Intronic
1129221962 15:74136305-74136327 CCCGGGCCGCGGCTCTCTGGAGG + Exonic
1129330890 15:74826586-74826608 CGTGGGGCGCGGGCCCGCGGCGG + Exonic
1131257471 15:90871787-90871809 CCCGGGGCCCGGCTGCCCGCCGG + Intronic
1132055336 15:98647737-98647759 TCCGGGGCGCGGGGCCCGCGAGG + Intergenic
1132478766 16:155229-155251 CCCGGGGCGCAAGTCCACCGGGG + Intronic
1132645590 16:997905-997927 TTCGGGGCGCGGCTCCCCTGGGG + Intergenic
1132683830 16:1154092-1154114 CCCGGGGCGCGGGACTCCCTCGG + Intronic
1132719648 16:1309481-1309503 CCCGGGGCGCGGGCGCGCGGCGG + Intronic
1132889331 16:2196309-2196331 CCGGGGGCGCGGGGCGCGGGTGG - Intronic
1133024122 16:2980298-2980320 GGCGGGGCGCGGGTCCGCGAGGG + Exonic
1133118250 16:3590497-3590519 CCCAGGGCGGGAGTCCCCGCGGG - Exonic
1133121564 16:3611707-3611729 CGCCGGGCGCGGGCCCGCGGCGG + Intronic
1133218505 16:4307794-4307816 GGCGGGGCCCGGGTCACCGGCGG + Intergenic
1133232104 16:4371793-4371815 CCCGGGGGGCGGGCCCGCCGCGG - Intronic
1136666717 16:31819351-31819373 CCCGGGCTGCGCTTCCCCGGAGG - Intergenic
1137412942 16:48244665-48244687 GCCTGGGCCCAGGTCCCCGGAGG - Intronic
1138327922 16:56191187-56191209 CCCGGCCCGCGGCTCCCCCGGGG - Intergenic
1139393557 16:66621887-66621909 CCCAGTGGGCGGGTCCGCGGTGG - Intronic
1139631820 16:68235968-68235990 CCAGGGGCAGGGGTCCGCGGCGG + Exonic
1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG + Exonic
1141184792 16:81779476-81779498 CCCTGGGAGCCGGTCCCCGCGGG - Intronic
1141754535 16:85982561-85982583 CCAGGGGCGGAGGACCCCGGTGG + Intergenic
1141841939 16:86579161-86579183 GCCGGGCCCCGGGGCCCCGGAGG + Exonic
1142206387 16:88785057-88785079 GGCGGCGCGCGGGTCCCCGCGGG - Exonic
1142293018 16:89201349-89201371 CGCGGGGCGCGGGCCCGGGGCGG + Intronic
1142367438 16:89657541-89657563 CCCCGCGCGCGAGTCCCCGGAGG + Intronic
1142367560 16:89657988-89658010 CCCTGGGCGCGGGCCCAGGGCGG + Intronic
1142414766 16:89935353-89935375 GCCGTGGCGCGGGTCGCAGGCGG - Exonic
1142631544 17:1229316-1229338 CCCGGCGGGCAGGTCCCCGCGGG + Intergenic
1142685581 17:1575348-1575370 CCCAGGCCCCGGGTCCCCGGGGG + Exonic
1142762570 17:2050670-2050692 TGCGGGGCGGGGGTCCCAGGAGG + Intergenic
1143328969 17:6120242-6120264 CCAGGGCTGCCGGTCCCCGGGGG - Intronic
1145884351 17:28372014-28372036 CCATGGGCGCGGGGCCGCGGGGG - Exonic
1145938162 17:28726883-28726905 CCCTCGGCCCGGCTCCCCGGAGG + Intronic
1146654452 17:34626803-34626825 CCCCGGGCCCGGCCCCCCGGCGG - Intronic
1148079445 17:44959796-44959818 CCCCGGGCGCGCCACCCCGGAGG + Exonic
1148207092 17:45785535-45785557 CCCGGGGCTCGGGACTCCGCAGG + Intronic
1148445323 17:47733780-47733802 CCCGGCGCGCGGGTCCGGGGCGG - Exonic
1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG + Intronic
1150675752 17:67245044-67245066 CCCGGGGTCCGGGACACCGGAGG + Intronic
1150747306 17:67825974-67825996 CCCGGGGCGCTGGTGCTGGGGGG - Exonic
1151662544 17:75526233-75526255 GCCGGAGCGCGGTGCCCCGGCGG + Intronic
1152175049 17:78782019-78782041 CGCGGGGCGGGGGTCGCAGGGGG - Intronic
1152175146 17:78782317-78782339 CGCGGGGCGCGGGGCGCCGGGGG - Intergenic
1152606658 17:81294939-81294961 CCCGGGGCGAGAGGCCTCGGGGG + Exonic
1152704984 17:81838771-81838793 CCCGAGGCGAGGGGCCCAGGGGG - Intergenic
1152711283 17:81871435-81871457 CGCGGCGCGCGGGTGGCCGGGGG + Intergenic
1152781438 17:82228891-82228913 CCCGGGCCGCAGCTCCCCGACGG - Intronic
1152782058 17:82231033-82231055 GCCGGCGCGCGGGTCCACCGGGG - Intronic
1153226868 18:2906565-2906587 CCCCGGGCAGGGGTCCCCGGCGG + Intronic
1153457428 18:5295890-5295912 CTCGGGGCGCGGGGGCACGGTGG + Exonic
1153855085 18:9137196-9137218 CCCCCGGCGCGGGTCCGCCGGGG + Intronic
1155176723 18:23307636-23307658 CCCGGGGCGCTGGTCACAGCTGG + Intronic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160540294 18:79617314-79617336 CCGGGGGGGCGGGGTCCCGGGGG - Intergenic
1160540367 18:79617429-79617451 CCCGGGGGGCGGGGTCCCGGGGG - Intergenic
1160540404 18:79617494-79617516 CCCGGGGGGCGGGGTCCTGGGGG - Intergenic
1160550192 18:79689902-79689924 CCCGTGGTGCTGGTTCCCGGCGG + Intronic
1160869727 19:1271688-1271710 CCCGGGTCCCAGGTCCCTGGGGG + Intronic
1160918817 19:1510456-1510478 CCCTGGGAGGGGGTCCCTGGGGG - Intronic
1161264669 19:3358789-3358811 CCTGGGGCGGGGGTCCCCTGGGG - Intergenic
1161298366 19:3531119-3531141 CCAGGGGAGCGAGTCCCAGGTGG - Intronic
1161319068 19:3632728-3632750 CCCGGGGCTCAGGTCCCCAGAGG + Exonic
1161425009 19:4198467-4198489 TCCGGGGCGCGGGGCGCGGGGGG - Intronic
1161766775 19:6212814-6212836 CCCGGGGGGCGGCTCCCGTGTGG + Intergenic
1161939830 19:7395321-7395343 CCTGGGGCGCGGGACCCCCGGGG + Intronic
1162145585 19:8610897-8610919 GCGGGGGCGCTGGTCCCGGGCGG - Intergenic
1162799521 19:13103036-13103058 CCTGGGGCCCGGGTCCCCAGAGG - Intronic
1162833109 19:13299083-13299105 GCCGAGGCGCTGGTCCACGGTGG + Exonic
1162897467 19:13773881-13773903 CGCGGGGCGCGGATCACCCGAGG - Intronic
1162954225 19:14089704-14089726 GCGGGGGCGCGAGTCCCGGGAGG - Intronic
1162964582 19:14149871-14149893 CCCGGGCCGCAGGCTCCCGGTGG + Exonic
1163488894 19:17605711-17605733 CCCGGGGCTCTGGTACCGGGAGG - Exonic
1167045909 19:47048510-47048532 CCCGGAGCGGGGGCGCCCGGGGG - Exonic
1167129156 19:47573086-47573108 CCCGGCGCGCGAGCCCCCGGGGG - Intergenic
1167256844 19:48435675-48435697 CCCGGGGCACGGATCTCCTGAGG - Intronic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
1167501663 19:49851628-49851650 CCCGGGGCCGGGTTCCCCCGTGG + Intronic
1167648139 19:50716789-50716811 CCCTGGCCCCGGGTCCCCCGGGG + Exonic
1168154467 19:54465170-54465192 CCCGGGGCGGGGTTCCGCGTCGG + Exonic
1168297345 19:55383858-55383880 CGCGGGGCGCTGGCCCGCGGCGG + Exonic
927713924 2:25341169-25341191 CGCGGGGCGGGGGACCCGGGAGG - Intronic
929133594 2:38602482-38602504 CCCGGGGCGTCGCTTCCCGGCGG + Exonic
929452904 2:42048412-42048434 CCCCGGGCCCGGGGCCCCCGCGG - Exonic
929701904 2:44169324-44169346 CCCAGGGCCCGGGGCCTCGGCGG - Intronic
932342999 2:70978577-70978599 CCCCGGGGGCGGGGCGCCGGCGG + Intronic
934566981 2:95346609-95346631 GCCGGGGCGCGGGGGCGCGGCGG - Intronic
934966905 2:98731225-98731247 CGCGGGGCGCGGGGCCCGCGGGG - Intergenic
935301551 2:101697724-101697746 CCCGGAGCGTGGGGCCGCGGCGG - Intronic
937986959 2:127642271-127642293 CCCAGGGCACGGCTCCCCGAGGG + Intronic
938073087 2:128318588-128318610 CGCGGGGCGCGGGGCCTGGGAGG + Intergenic
942261722 2:174171944-174171966 CACAGGGAGCGGGGCCCCGGCGG + Intronic
942446068 2:176079967-176079989 CCCGGGGCGCGGGAGGCCGAAGG - Exonic
945251692 2:207769939-207769961 GCCGGGGCGGGGCTTCCCGGCGG - Intergenic
947674184 2:231962099-231962121 CCCGAGGCTCGGGTCACCTGTGG + Intronic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948865935 2:240774912-240774934 CCCAGGGCATGGGTCCCCAGTGG + Intronic
948934050 2:241150714-241150736 CCCGGGCCGGGGCTCCCCCGAGG - Intronic
1169193990 20:3673709-3673731 ACCCGGACGCGGGTCCCGGGTGG - Intronic
1169367164 20:5001204-5001226 CCCGGGGCCAGGGTGGCCGGCGG + Intronic
1170026176 20:11891309-11891331 CGCGGGGTGCGCGACCCCGGAGG + Intronic
1173280000 20:41618865-41618887 CCCGGGGCTGGCGTCTCCGGGGG + Intergenic
1174494837 20:50931725-50931747 CCCGGGGCCCGTGTGCTCGGCGG + Intergenic
1175036517 20:56005391-56005413 CGCGCAGCGCGGGTCCGCGGCGG - Exonic
1175507068 20:59493636-59493658 CACAGTGCGCGGGACCCCGGTGG - Intergenic
1175902960 20:62367179-62367201 GCAGCGGCGCGGGGCCCCGGGGG + Exonic
1175931830 20:62497204-62497226 CCTGAGGCCCGGGTCCCTGGGGG - Intergenic
1176223233 20:63979736-63979758 CCCTGGGCACGGCTCCGCGGAGG + Intronic
1176547923 21:8209374-8209396 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1176555818 21:8253588-8253610 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1176566855 21:8392408-8392430 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1176574755 21:8436622-8436644 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1176611369 21:8987915-8987937 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1177188114 21:17819672-17819694 CCCGGGGCGGGGGCCGCAGGCGG + Intergenic
1178109619 21:29357198-29357220 AACGGGGCGCTGGTCCCTGGGGG + Intronic
1178695747 21:34792032-34792054 CCCAGGGCCCGGGATCCCGGCGG + Exonic
1179605835 21:42514467-42514489 CCTGGGCGGCTGGTCCCCGGAGG - Exonic
1181077875 22:20393642-20393664 CCATGGGCGCGGGTCCCCAGAGG - Intergenic
1181085796 22:20438765-20438787 AGCAGGGTGCGGGTCCCCGGGGG + Intronic
1181570103 22:23763783-23763805 CCGTGGGGGCGGGTCCCGGGAGG + Intronic
1184035185 22:41914794-41914816 CTCGGGGCTGGGGTCCCCAGAGG - Intergenic
1184523562 22:45009122-45009144 CCCGGGGCGCGGGGGCCCGAGGG + Intronic
1184663370 22:45975752-45975774 GGCGGGGCCCGGGTCCCCGCAGG + Intronic
1184753535 22:46502940-46502962 CCCCGGGAGCAGGTCCCCGCAGG + Intronic
1184996252 22:48209652-48209674 CCCTGGGCGGGGGTCCCCCACGG - Intergenic
1185043923 22:48519547-48519569 CTCGGGGTGTGGGTCCCCTGTGG + Intronic
1185133176 22:49052132-49052154 CCAGGAGCGCGTGTCCCCGCCGG + Intergenic
1185206328 22:49541251-49541273 CCCAGGGCGCGGGCACCGGGAGG + Intronic
1203252803 22_KI270733v1_random:125673-125695 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1203260859 22_KI270733v1_random:170759-170781 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
950043244 3:9933522-9933544 CCCGGCGCGGGAGTCCCCGGGGG - Exonic
950215268 3:11154438-11154460 CTCGGGGAGCGGGGCGCCGGAGG - Intronic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
953657076 3:44862264-44862286 CCCGCGGCCCGGGGCCCCGGCGG - Intronic
954375817 3:50193687-50193709 CGCGGGGCGCGGGGCGCAGGGGG + Intronic
954632914 3:52056604-52056626 TCCGGGGGGCGGGGCCGCGGGGG + Intergenic
954778871 3:53045331-53045353 CCCGGGGGGCGGGTCCGCGGGGG + Intronic
956675025 3:71725300-71725322 GCGGCGGCGCGGGACCCCGGCGG + Exonic
960902281 3:122564644-122564666 CCCGGGGGCCGGGCCCCCAGAGG - Intronic
961222649 3:125212547-125212569 GCCGGCGCGCGGGTGACCGGCGG + Intronic
966108222 3:176362484-176362506 CCCGGGGCCCGCGCCGCCGGCGG + Intergenic
966182015 3:177197026-177197048 CCGGGGGCGCTGGGCCGCGGGGG - Intronic
966712012 3:182980695-182980717 CCGGGCGCGGGGGTCCCCCGGGG + Intronic
967087292 3:186107662-186107684 CCCGGGGCGCGGGTGGTGGGGGG - Intronic
968603675 4:1521495-1521517 GCCGGGCCACGGGGCCCCGGCGG - Intergenic
968901670 4:3435040-3435062 CCTGGGGCTGGGGTCCCCTGGGG + Intronic
969330376 4:6471125-6471147 CCCTGGGCACGGGTCCCGCGGGG - Intronic
969436622 4:7192693-7192715 CCCGGGGCTCGGGGCTCGGGCGG - Exonic
973774243 4:54230642-54230664 TCCAGGGCTCGGGTGCCCGGAGG - Intronic
974716020 4:65669704-65669726 CCCGGGGTGCGGGACGCCGGCGG - Exonic
976388094 4:84482956-84482978 CCCGGGGCGCGTGTCAGCGTTGG + Intergenic
978384493 4:108166994-108167016 CCCGCGGCCCGGCTCACCGGTGG + Intronic
984735005 4:183099821-183099843 CCTCGGGGCCGGGTCCCCGGAGG - Intronic
984888646 4:184473248-184473270 CCCGGGGCGCGGGCCGCGGCGGG - Intronic
985005916 4:185535395-185535417 CCCAGGGCGCAGGGCCCGGGAGG + Exonic
985423562 4:189807199-189807221 CGCGGGGCGCGGGTTCCAGGTGG - Intergenic
985845092 5:2338705-2338727 CACGGGGCTCGGGTCTCAGGAGG - Intergenic
986297214 5:6449302-6449324 CACGGGGCCCGGGCGCCCGGCGG - Intronic
986333703 5:6736989-6737011 CCTGGGCCGCGGGGCCCCTGAGG + Intronic
986721384 5:10563706-10563728 CCCCGGGCACAGGTCCCAGGTGG + Intergenic
987099954 5:14582341-14582363 CCCGGGGCGCGTGGACCCGCGGG + Intronic
989963307 5:50440975-50440997 CGCGAGGCTCGGGTCCCCGCGGG - Intronic
992716306 5:79514223-79514245 CCCCGGCCGCGGCTCCGCGGCGG - Intergenic
992962835 5:81972441-81972463 CCGGGGAAGCGGGTCCCCGCCGG + Intronic
996948270 5:129095172-129095194 CGCAGGGCCCGGGTCCCGGGCGG - Intronic
1000041182 5:157486378-157486400 CCTGGGCCCCGGGTCCCAGGTGG - Intronic
1001902769 5:175444916-175444938 GTCGGGGCGCGGGTCCCTGGCGG - Intergenic
1002431169 5:179204805-179204827 CCCGGGGCGTGGGAGACCGGCGG - Intronic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1002721119 5:181261852-181261874 CCCCGGTCGTGGGTCCCCTGAGG + Intergenic
1003097479 6:3154277-3154299 GCCGTGGCGCGGGTCGCAGGCGG + Exonic
1003107019 6:3225165-3225187 GCCGTGGCGCGGGTCGCAGGCGG + Exonic
1003139145 6:3456731-3456753 CCCGGGGCGCGGGGTCCGGCGGG - Intronic
1003624257 6:7727709-7727731 CCCGGCGCGCGGGTCCCGCCTGG + Intronic
1005385298 6:25279455-25279477 CCCGGCTCGCTGGTCCCCGGCGG - Exonic
1006341958 6:33452136-33452158 CCTGGGGCAAGGGTCCCTGGGGG - Exonic
1007079214 6:39086821-39086843 CCCAGGGCTGGGTTCCCCGGTGG - Exonic
1008381876 6:50845975-50845997 CCCGGGGCGCCGGCTCCTGGAGG + Exonic
1012472921 6:99590903-99590925 CGCGGGGCGGTGGTGCCCGGCGG + Intergenic
1017662392 6:156687331-156687353 CGCGGGGTCCGGGTCCCGGGCGG + Intergenic
1017665914 6:156720104-156720126 CCCGGGGAGCGGGTGCGGGGCGG - Intergenic
1017842244 6:158231917-158231939 CCGGGGGCGGGGGTCTCCCGGGG + Intergenic
1019309161 7:351908-351930 CACGGGGCGCTCGTCCCTGGAGG - Intergenic
1019457538 7:1138253-1138275 CCTGGGGCGCGGGTCCCTGCCGG - Intronic
1019471927 7:1225587-1225609 CCCGGGGCCAGAGTCCCCAGAGG - Intergenic
1019487653 7:1296644-1296666 CCCGAGGCCCGGGACCCAGGTGG - Intergenic
1019746404 7:2702658-2702680 CCCGGGGAGAGGGTCCCAGGCGG + Intronic
1020274303 7:6615521-6615543 GCCGGGGCGCGGGGGCGCGGCGG + Intergenic
1020771707 7:12403754-12403776 CCCGGGCCGCGGGTGCCAGGAGG + Exonic
1021992507 7:26152134-26152156 CCACGGGCGCGGGCCCCGGGCGG + Intergenic
1024579934 7:50793284-50793306 CGGCGGGCGCGGGTCCCCGCGGG + Intronic
1024766795 7:52669239-52669261 CCCAGGGCGCGGCTCGCCGTTGG - Intergenic
1031043424 7:116862473-116862495 CCCGGGGTGCGCGTGCGCGGCGG + Exonic
1032298770 7:130668324-130668346 CCCTGCGCGCGGGCCTCCGGCGG - Intronic
1032523906 7:132564845-132564867 CCAGAGGCCTGGGTCCCCGGGGG - Intronic
1033333760 7:140435470-140435492 CCCGGGGCGCGGGACCACACTGG + Intergenic
1034269706 7:149797639-149797661 CCCTGTGCCCGGGTCCCCAGGGG + Intergenic
1034349638 7:150407629-150407651 CTCCGGGGGCGGGTCCCCTGCGG + Intronic
1035266307 7:157691935-157691957 CCCGGTGCGCGGCGCCCCCGCGG + Intronic
1035297081 7:157873374-157873396 CTCGGGGCGCGGCCCTCCGGGGG - Intronic
1035747712 8:1973992-1974014 CCCGAGGCGCGGGTCGGAGGGGG + Intronic
1037769185 8:21789039-21789061 CGCGGGGCGCGGGAGCGCGGCGG + Intronic
1037779961 8:21861195-21861217 CCCGTGGTGCGGCTCCCGGGTGG + Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1038039776 8:23714855-23714877 CCCGGGTCGCGGTTCCCTGCGGG + Intergenic
1038311418 8:26449064-26449086 ATCGGGGCGCGGGTCCAGGGTGG - Intronic
1038449960 8:27633699-27633721 GGCGGGGCGCGGGGCCCCCGCGG + Intergenic
1038726016 8:30083150-30083172 CCAGGGGCGGGGGCCCACGGCGG - Exonic
1040515549 8:48131144-48131166 CACGGGGCGGGCGTCCCCGGGGG + Intergenic
1040981619 8:53251180-53251202 CCCGGGCCGCAAGTCGCCGGGGG + Intronic
1042785195 8:72537790-72537812 CGCGGGGAGAGGCTCCCCGGAGG + Exonic
1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG + Intronic
1048307983 8:133296969-133296991 CCCGGGGCGCGGGCGCGAGGGGG - Exonic
1048980813 8:139702671-139702693 CCCGGGGCGCGGGAGCCCAGCGG + Intronic
1049002116 8:139832796-139832818 CCAAGGGCGAGGGTCTCCGGGGG - Intronic
1049387937 8:142353706-142353728 GCCGGGGCTCTGGTCCCCAGGGG - Intronic
1049532027 8:143159680-143159702 CTTGGGGCGCGGGTCCTCTGGGG + Exonic
1049774578 8:144398475-144398497 CCTGGGGCTGGGGTCCCCTGCGG - Intronic
1051170606 9:14315458-14315480 CCCGGGGCCCGGGGCGCCGGCGG + Intronic
1056406624 9:86281992-86282014 CCGGTGGCGGGGGTTCCCGGTGG - Intronic
1056406649 9:86282084-86282106 CCGGGGGTGGGCGTCCCCGGGGG - Intronic
1056732477 9:89178102-89178124 GCCGGGGCGCGGGGCGCCGAGGG + Exonic
1057547009 9:96026369-96026391 GCCAGGGCGCGGATCCCAGGAGG + Intergenic
1060355651 9:122905049-122905071 CCCGGGTGCCTGGTCCCCGGCGG - Intronic
1060480017 9:124012307-124012329 CCGGGGGCGCGGCTCCTCCGAGG - Exonic
1061190793 9:129081451-129081473 CCCGGGTCCCGGGGCGCCGGTGG + Intronic
1061415573 9:130445222-130445244 GCGGGGGCGCGAGTCCCCGGGGG + Intronic
1061540697 9:131276782-131276804 AGCGCGGCGCGGGTCCCCGTCGG + Intergenic
1061987153 9:134136349-134136371 GCCGGGGCGGGGGTCCCGGGCGG - Intronic
1062042052 9:134408703-134408725 CCTGGGGCCCTGGTCCCTGGTGG + Intronic
1062092118 9:134683798-134683820 CCTGGGGCGCCGGCACCCGGTGG + Intronic
1062344649 9:136109232-136109254 CCCTGGGCCCGGGTCACCGCTGG + Intergenic
1062507559 9:136886021-136886043 CGCGGGACGCGGGGCCCTGGCGG - Intronic
1062696359 9:137878019-137878041 CGGGGGGCCCGGGTCCCGGGGGG + Exonic
1062718643 9:138023497-138023519 CCACCGGCGCGGCTCCCCGGAGG + Exonic
1203469206 Un_GL000220v1:108824-108846 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1203477027 Un_GL000220v1:152796-152818 TCTGTGGCGCGGGGCCCCGGTGG + Intergenic
1185456125 X:311720-311742 CCCGGGGTGCGGCCCCCCAGAGG - Intronic
1185471450 X:386453-386475 CCCGGCCCGGGGGTTCCCGGGGG + Exonic
1192496000 X:71616970-71616992 CGCGGGCCGGGGGCCCCCGGCGG + Exonic
1199881173 X:151974947-151974969 CCCGCGGCGCGGGGCCTGGGCGG + Intergenic