ID: 910256306

View in Genome Browser
Species Human (GRCh38)
Location 1:85250461-85250483
Sequence TTCCCAGGACATCTCTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910256302_910256306 2 Left 910256302 1:85250436-85250458 CCACATGGACACTTGTGCAAACA 0: 1
1: 0
2: 1
3: 21
4: 223
Right 910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 361
910256300_910256306 11 Left 910256300 1:85250427-85250449 CCTCAGTACCCACATGGACACTT 0: 1
1: 0
2: 1
3: 37
4: 204
Right 910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 361
910256301_910256306 3 Left 910256301 1:85250435-85250457 CCCACATGGACACTTGTGCAAAC 0: 1
1: 0
2: 1
3: 14
4: 143
Right 910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 361
910256298_910256306 21 Left 910256298 1:85250417-85250439 CCAAACTTCACCTCAGTACCCAC 0: 1
1: 0
2: 1
3: 14
4: 205
Right 910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910256306 Original CRISPR TTCCCAGGACATCTCTAAAG GGG Intronic
903484899 1:23682384-23682406 TTCCCAGAATAGCTCTTAAGTGG - Intergenic
904001107 1:27339274-27339296 ATCTCAGGACGTGTCTAAAGGGG + Intergenic
906975047 1:50561230-50561252 CTCCCAGGCCATCTGGAAAGTGG - Intronic
907836568 1:58114475-58114497 TTGCCAGGACATCCCTAACATGG + Intronic
909482232 1:76138553-76138575 TTCCCAGCACCTCCCTAAAATGG + Intronic
909850014 1:80449600-80449622 TTACCATGACATCCCAAAAGAGG - Intergenic
909881315 1:80882526-80882548 TTCCCAGAAAATCTCTAAAAGGG + Intergenic
910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG + Intronic
912639753 1:111333495-111333517 TTCCCAGCACATCTCCAAACTGG + Intergenic
916913214 1:169374626-169374648 TTCCCAGAACATTTCTACATGGG + Intronic
918096937 1:181343767-181343789 TTCCCATGACCTCTCTAAAGAGG + Intergenic
918417940 1:184331723-184331745 TCCCAAGGGCACCTCTAAAGAGG - Intergenic
919979770 1:202635627-202635649 TTCTAAGGCCATTTCTAAAGTGG + Intronic
922618982 1:226979229-226979251 TTCGCAGGACCTCTCCACAGAGG - Intronic
1064632004 10:17325931-17325953 TTCCCAAAACATCTGTAATGAGG - Intronic
1064771537 10:18728710-18728732 TAGCCAAGACATCTCCAAAGTGG + Intergenic
1066185609 10:33007549-33007571 TTGCCAGGGCATTTCTAAAAGGG + Intergenic
1066687261 10:37992989-37993011 TTCCCAGGAAATTTCTTGAGTGG - Intergenic
1072531772 10:96326466-96326488 TTCCCATGTTATCTCTAATGGGG - Intronic
1074060907 10:109964742-109964764 TTCCCAGGACAGCAAGAAAGTGG + Intergenic
1074825359 10:117211004-117211026 TTCCCTGGACATTTCTACACTGG + Intergenic
1075145753 10:119881697-119881719 TTCCTTGGCCATATCTAAAGTGG - Intronic
1075222575 10:120598061-120598083 TCCCCAGTTCATCTGTAAAGTGG - Intergenic
1075373987 10:121963084-121963106 TTCACATGAAATTTCTAAAGGGG + Intronic
1075989779 10:126825796-126825818 TTCCCAGCAGCTCTCCAAAGTGG - Intergenic
1076283393 10:129270698-129270720 TTCTCAGAACATCTCCAAAGGGG - Intergenic
1077400962 11:2357135-2357157 TTCCCTGGTCTTCTCCAAAGGGG + Intergenic
1079604951 11:22353843-22353865 CCCCCAGGACATCACAAAAGGGG - Intronic
1081137332 11:39454318-39454340 TTCCCTAGAAATCTCCAAAGGGG - Intergenic
1082402142 11:52250216-52250238 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082431429 11:52673540-52673562 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082438271 11:52772147-52772169 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082446396 11:52889427-52889449 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082497980 11:53634779-53634801 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082505383 11:53742418-53742440 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082524172 11:54013988-54014010 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1082554717 11:54549752-54549774 TTCCAAGGACATCTTCAAAGAGG - Intergenic
1085767090 11:79292590-79292612 TTCCCAGTAATTCTCTGAAGGGG + Intronic
1087471933 11:98586500-98586522 TTCCAATGACATCTATAAAGTGG + Intergenic
1089455177 11:118621697-118621719 TTCCCTGAACATTTCTAAATGGG + Intronic
1090470845 11:126979620-126979642 TCCCCAGGTCATCTCTCTAGTGG - Intronic
1090598969 11:128349983-128350005 TTCCCAGCACATCTAAAGAGTGG + Intergenic
1090630872 11:128646189-128646211 TTGCAAGGAAGTCTCTAAAGAGG + Intergenic
1092485193 12:8897018-8897040 TTCCTTGGTCATATCTAAAGAGG + Intergenic
1093020889 12:14202851-14202873 TTCCTTGGACATAGCTAAAGAGG + Intergenic
1095128060 12:38505622-38505644 ATCACAAGACATCTCCAAAGTGG + Intergenic
1097035966 12:56123819-56123841 TTGCCAGGTTATCTCCAAAGAGG + Exonic
1098086605 12:66851265-66851287 TACACAGGACATCTGGAAAGTGG + Intergenic
1098827336 12:75313242-75313264 TTTGCAGGACATCTCTTGAGGGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102859624 12:116324175-116324197 TTCTCTGGACATATCTAAATAGG + Intergenic
1105206838 13:18232711-18232733 TGCCCAGGGCATCGCTAATGAGG + Intergenic
1105207450 13:18235642-18235664 TGCCCAGGGCATCGCTAATGAGG + Exonic
1105207718 13:18236788-18236810 TGCCCAGGGCATCGCTAACGAGG + Exonic
1105631261 13:22171157-22171179 TTCTCAGGACATCTGTAAGTTGG - Intergenic
1105809498 13:23982202-23982224 TTCCTATGACCTCTCTAATGTGG - Intronic
1105952783 13:25245837-25245859 TTCCCAGGACAGAGTTAAAGTGG - Intergenic
1106281351 13:28275274-28275296 ATCCCATCACCTCTCTAAAGCGG - Intronic
1106469852 13:30044678-30044700 TGCCCAGGTCATTGCTAAAGAGG + Intergenic
1106850354 13:33783362-33783384 TTCCCTGGACAACTATGAAGAGG + Intergenic
1110275675 13:73639634-73639656 TTCCCAAAACATCTGGAAAGTGG + Intergenic
1110371360 13:74744164-74744186 TGCCAACAACATCTCTAAAGGGG - Intergenic
1111275864 13:85946097-85946119 TTCCTAGGATATCCCTAAAGGGG - Intergenic
1112394200 13:99013645-99013667 TTCCCAGGACATCTCCACCAGGG - Intronic
1114252979 14:20977494-20977516 TCCCCAGGACATCTCTAACAAGG + Intergenic
1116544151 14:46141824-46141846 TTAAAAGGCCATCTCTAAAGAGG - Intergenic
1119131089 14:72173902-72173924 TGCCCAGGCCACCTGTAAAGAGG + Intronic
1119942662 14:78657485-78657507 TTCTCATGGCATCTCTAATGGGG + Intronic
1122610125 14:102976717-102976739 TGACCAGGTCTTCTCTAAAGGGG - Intronic
1125188664 15:36963621-36963643 TTCCCAGGCCATTTCAAAATTGG - Intronic
1125260860 15:37823295-37823317 TTCCCAGGATATTTTTTAAGTGG + Intergenic
1125757588 15:42073965-42073987 TTTGCAGGAAATCTCTAAATAGG + Intronic
1128700800 15:69802797-69802819 TTCAAAGGACAACTCTTAAGAGG + Intergenic
1135156646 16:20058591-20058613 TTCCAAGGACATCTTGAAAATGG - Intronic
1136683032 16:31978886-31978908 TCCCCAGGACATCTCCACTGGGG - Intergenic
1136783670 16:32922442-32922464 TCCCCAGGACATCTCCACTGGGG - Intergenic
1136886118 16:33931364-33931386 TCCCCAGGACATCTCCACTGGGG + Intergenic
1140648493 16:77061372-77061394 TTCTCAGGATATATCAAAAGTGG + Intergenic
1203086321 16_KI270728v1_random:1186443-1186465 TCCCCAGGACATCTCCACTGGGG - Intergenic
1145418552 17:22745824-22745846 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145418724 17:22748203-22748225 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145419062 17:22752958-22752980 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145419577 17:22760094-22760116 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145419904 17:22814671-22814693 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145420073 17:22817049-22817071 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145420242 17:22819428-22819450 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145420326 17:22820622-22820644 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145420495 17:22823001-22823023 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145420668 17:22825381-22825403 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145420843 17:22827760-22827782 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145421187 17:22832517-22832539 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145421358 17:22834897-22834919 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145421536 17:22837276-22837298 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145421710 17:22839655-22839677 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145421882 17:22842034-22842056 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145422056 17:22844414-22844436 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145422232 17:22846792-22846814 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145422407 17:22849171-22849193 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145422583 17:22851550-22851572 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145422758 17:22853929-22853951 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145422930 17:22856308-22856330 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145423105 17:22858686-22858708 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145423281 17:22861065-22861087 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145423453 17:22863444-22863466 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145423623 17:22865823-22865845 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145423795 17:22868202-22868224 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145423966 17:22870581-22870603 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145424134 17:22872960-22872982 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145424306 17:22875339-22875361 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145424483 17:22877718-22877740 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145424657 17:22880097-22880119 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145424835 17:22882476-22882498 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145425005 17:22884855-22884877 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145425172 17:22887234-22887256 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145425343 17:22889613-22889635 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145425519 17:22891992-22892014 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145425694 17:22894371-22894393 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145425862 17:22896748-22896770 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145426038 17:22899127-22899149 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145426211 17:22901507-22901529 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145426380 17:22903884-22903906 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145426552 17:22906263-22906285 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145426890 17:22911022-22911044 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145427060 17:22913403-22913425 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145427227 17:22915783-22915805 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145427396 17:22918162-22918184 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145427575 17:22920541-22920563 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145427748 17:22922921-22922943 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145427918 17:22925299-22925321 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145428090 17:22927678-22927700 TTCCAATGACATCTTTAAAGAGG - Intergenic
1145428261 17:22930057-22930079 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145428611 17:22934816-22934838 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145428780 17:22937196-22937218 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145428954 17:22939576-22939598 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145429300 17:22944334-22944356 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145429474 17:22946713-22946735 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145429645 17:22949092-22949114 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145429817 17:22951470-22951492 TTCCAAAGTCATCTCCAAAGAGG - Intergenic
1145429991 17:22953849-22953871 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145430159 17:22956227-22956249 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145430338 17:22958606-22958628 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145430691 17:22963366-22963388 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145430862 17:22965746-22965768 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145431035 17:22968127-22968149 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145431216 17:22970506-22970528 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145431386 17:22972887-22972909 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145431562 17:22975266-22975288 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145431904 17:22980025-22980047 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145432078 17:22982404-22982426 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145432254 17:22984784-22984806 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145432422 17:22987164-22987186 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145432594 17:22989547-22989569 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145432770 17:22991930-22991952 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145432945 17:22994309-22994331 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145433117 17:22996688-22996710 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145433293 17:22999067-22999089 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145433375 17:23000259-23000281 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145433545 17:23002624-23002646 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145433717 17:23005004-23005026 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145433889 17:23007383-23007405 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145434069 17:23009763-23009785 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145434245 17:23012142-23012164 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145434419 17:23014522-23014544 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145434591 17:23016902-23016924 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145434935 17:23021660-23021682 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145435105 17:23024040-23024062 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145435275 17:23026420-23026442 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145435448 17:23028798-23028820 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145435619 17:23031178-23031200 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145435787 17:23033557-23033579 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145435952 17:23035936-23035958 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145436122 17:23038315-23038337 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145436299 17:23040694-23040716 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145436477 17:23043075-23043097 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145436812 17:23047834-23047856 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145436984 17:23050214-23050236 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145437332 17:23054974-23054996 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145437509 17:23057353-23057375 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145437682 17:23059733-23059755 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145437854 17:23062109-23062131 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145438023 17:23064488-23064510 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145438191 17:23066867-23066889 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145438358 17:23069246-23069268 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145438532 17:23071625-23071647 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145438707 17:23074005-23074027 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145438874 17:23076390-23076412 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145439046 17:23078769-23078791 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145439216 17:23081148-23081170 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145439383 17:23083527-23083549 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145439728 17:23088285-23088307 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145439810 17:23089477-23089499 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145439979 17:23091856-23091878 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145440151 17:23094235-23094257 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145440324 17:23096612-23096634 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145440492 17:23098991-23099013 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145440670 17:23101373-23101395 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145440839 17:23103752-23103774 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145441009 17:23106131-23106153 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145441183 17:23108510-23108532 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145441362 17:23110891-23110913 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145441536 17:23113271-23113293 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145441707 17:23115650-23115672 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145441880 17:23118030-23118052 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145442059 17:23120410-23120432 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145442233 17:23122789-23122811 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145442410 17:23125170-23125192 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145442581 17:23127550-23127572 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145442750 17:23129933-23129955 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145442923 17:23132313-23132335 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443092 17:23134692-23134714 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443172 17:23135886-23135908 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443191 17:23136228-23136250 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443342 17:23138265-23138287 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443517 17:23140644-23140666 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443687 17:23143023-23143045 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443859 17:23145404-23145426 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145443878 17:23145746-23145768 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145444033 17:23147784-23147806 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145444381 17:23152543-23152565 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145444729 17:23157302-23157324 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145444909 17:23159682-23159704 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145445086 17:23162061-23162083 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145445257 17:23164442-23164464 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145445428 17:23166821-23166843 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145445605 17:23169201-23169223 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145445779 17:23171580-23171602 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145445952 17:23173961-23173983 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145446293 17:23178719-23178741 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145446471 17:23181098-23181120 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145446640 17:23183477-23183499 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145446810 17:23185853-23185875 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145446979 17:23188233-23188255 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145447150 17:23190612-23190634 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145467100 17:23481378-23481400 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145475331 17:23600812-23600834 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145475819 17:23607934-23607956 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145477526 17:23633050-23633072 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145487505 17:23777744-23777766 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145516715 17:24202885-24202907 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145567865 17:24947067-24947089 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145604259 17:25477055-25477077 TTCCAACGACATCTTCAAAGAGG - Intergenic
1145635865 17:25936268-25936290 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145636937 17:25951714-25951736 TTCCAACGACATCTTCAAAGAGG - Intergenic
1145643353 17:26045050-26045072 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145647698 17:26108341-26108363 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145660025 17:26287002-26287024 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145672364 17:26466431-26466453 TTCCAACGACATCTTCAAAGAGG - Intergenic
1145679296 17:26567529-26567551 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145679478 17:26570131-26570153 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145679646 17:26572514-26572536 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145679665 17:26572856-26572878 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145679807 17:26574895-26574917 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145679969 17:26577278-26577300 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145680136 17:26579660-26579682 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145680298 17:26582040-26582062 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145680467 17:26584422-26584444 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145680634 17:26586801-26586823 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145680704 17:26587819-26587841 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145680871 17:26590201-26590223 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145681057 17:26592803-26592825 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145681222 17:26595185-26595207 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145681392 17:26597565-26597587 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145681557 17:26599948-26599970 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145681721 17:26602330-26602352 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145681886 17:26604710-26604732 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145682051 17:26607093-26607115 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145682222 17:26609476-26609498 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145682390 17:26611858-26611880 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145682549 17:26614238-26614260 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145682756 17:26617243-26617265 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145683099 17:26622003-26622025 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145683266 17:26624378-26624400 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145683284 17:26624720-26624742 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145683430 17:26626759-26626781 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1145707080 17:26880877-26880899 TTCCAAAGACATCTTCAAAGAGG + Intergenic
1145707222 17:26882915-26882937 TTCCAACGACATCTTCAAAGAGG + Intergenic
1145707384 17:26885123-26885145 TTCCAACGACATCTTCAAAGAGG + Intergenic
1151902315 17:77024557-77024579 TTCCCAGGTAATCTCTGAAGAGG + Intergenic
1152179980 17:78813424-78813446 TTCCCAGCATATCCCTACAGGGG + Intronic
1153508071 18:5823725-5823747 GTCCCAGGAAATGTCTGAAGGGG - Intergenic
1155791478 18:29976057-29976079 TTCCCATGGTATCTCTATAGTGG + Intergenic
1160220157 18:76970249-76970271 ATCTCAGGACATCTCTAAAAGGG + Exonic
1161017698 19:1991422-1991444 TCCCGAGGACACCTCTCAAGTGG + Intronic
1161347912 19:3777318-3777340 TCCCCAGGCCATCCCTAAATGGG + Intergenic
1166077195 19:40420751-40420773 TTCCCCGGACATCTGTCCAGTGG - Intergenic
1166094256 19:40529734-40529756 TTACTAGGCCATCTCTAATGTGG - Intronic
1166364258 19:42270498-42270520 TTCTCAGGGCAGCTCGAAAGGGG + Intronic
1167341013 19:48916306-48916328 GTCCCAGCACAGCTCTAGAGAGG + Intronic
930582845 2:53232962-53232984 TTCCCAAGACATGTCTTCAGTGG + Intergenic
938177028 2:129143153-129143175 TTCCAGGGACATCTCTAGTGAGG - Intergenic
939820460 2:146950562-146950584 TTTCCAGGGCCTCTCTGAAGTGG + Intergenic
940861181 2:158771881-158771903 GTTACAGGACATCTATAAAGTGG + Intergenic
942079968 2:172390900-172390922 TTCCCAGAACATTTCCAAACAGG - Intergenic
942308769 2:174634748-174634770 TTCCCAGGACACAGGTAAAGAGG + Intronic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
946451984 2:219787984-219788006 TTTTCAAGTCATCTCTAAAGGGG + Intergenic
947137895 2:226993364-226993386 TTCCCAGGCCATCTGGAATGAGG + Intronic
1169212312 20:3773649-3773671 TTCCCAGCACATCTCTAATAGGG - Intergenic
1169595174 20:7190258-7190280 TTCACAGGAGATCACTCAAGTGG + Intergenic
1170319731 20:15082002-15082024 TGCCTAGGACATCTATAAATTGG - Intronic
1179771771 21:43624968-43624990 TTCTCTGGACATCTGTAAGGTGG - Intronic
1181072572 22:20354896-20354918 CGCCCAGGGCATCTCTAAGGAGG + Intronic
1181072878 22:20356440-20356462 CGCCCAGGGCATCTCTAAGGAGG + Intronic
1181073913 22:20361856-20361878 CGCCCAGGACATCGCTAACGAGG + Intronic
1181287260 22:21762279-21762301 TTCCCTGGTTCTCTCTAAAGAGG - Exonic
1182431899 22:30304072-30304094 TGACCAGGTCATCTGTAAAGTGG + Intronic
1183273458 22:36876251-36876273 TTCCCCGCTCATCTCTAAAGTGG - Intronic
1184189440 22:42885209-42885231 TTCCTAAGACATGGCTAAAGTGG + Intronic
951079247 3:18431661-18431683 TACTCAGGACATCTCTGAGGTGG + Intronic
952931894 3:38367018-38367040 TTGTCAGGACATTTCCAAAGAGG + Intronic
955867498 3:63400598-63400620 TTCCCAGGTTATCTCGAAAAAGG - Intronic
957498610 3:81024072-81024094 TTCACAGGAAATTTCTAAAAGGG + Intergenic
960885214 3:122386838-122386860 TTCACAGGACCTCTCAAATGTGG - Intronic
962923968 3:139975023-139975045 GTCCCAGGATATCTCTATGGAGG + Intronic
967450933 3:189622028-189622050 TTCTCAGGGCATCTTTACAGGGG - Intergenic
969339656 4:6532170-6532192 TGGCCAGGCCATCTGTAAAGTGG - Intronic
970506945 4:16741363-16741385 GTCCAAGGACATCTCCAGAGAGG + Intronic
971007589 4:22392327-22392349 TTCCAAGATCATCTCAAAAGTGG - Intronic
983583691 4:169334143-169334165 TTCCTTTGACATCTCTAAAATGG - Intergenic
990831367 5:59962195-59962217 TTTCCAGATCATCTCAAAAGTGG + Intronic
992524200 5:77590738-77590760 TTGCCACGACATCTGTCAAGGGG - Intronic
994050618 5:95358373-95358395 TTCCCCAGACATCTCCGAAGGGG - Intergenic
994665903 5:102705041-102705063 TTCCCGCTCCATCTCTAAAGAGG + Intergenic
996038586 5:118786002-118786024 TTACTGGGTCATCTCTAAAGAGG - Intergenic
997698405 5:135879496-135879518 TTCACAGGACATCCCAAAAGTGG - Intronic
999698526 5:154207314-154207336 CTCCCAGGACAGCTCTCGAGGGG - Intronic
999698655 5:154208018-154208040 CTCCCAGGACAGCTCTCGAGGGG + Intronic
999796855 5:154996886-154996908 TTCCTAGGAGATCCTTAAAGGGG - Intergenic
1000924487 5:167177341-167177363 GTCACAGGACATCTTTAAAGAGG - Intergenic
1002773908 6:312409-312431 TTCCCAGGGCCGCTCTAATGTGG + Intronic
1003490259 6:6615028-6615050 TTCTTAGGACATCTATGAAGGGG + Intronic
1006981403 6:38151103-38151125 TTCCCAGGCAATCTCTAGAGCGG - Intronic
1007948023 6:45843401-45843423 TACCAAGGACATCTTTGAAGTGG + Intergenic
1008008676 6:46439864-46439886 TTCCCTGAAAATTTCTAAAGAGG + Intronic
1008277147 6:49554930-49554952 CTCCCAGGACATTTGTAAACGGG - Intronic
1013639966 6:112064591-112064613 TTCACAGGACATCTGTAGAAAGG - Intronic
1014355526 6:120404388-120404410 TTCCCAGGAAATAACTAAATTGG - Intergenic
1015859744 6:137663053-137663075 TTCCCAGTACATCGGTAAAGTGG - Intergenic
1016944265 6:149514129-149514151 TTCCCATGAGATGGCTAAAGAGG + Intronic
1017514059 6:155140084-155140106 ATCACATGACATCTCTAATGAGG - Intronic
1017841598 6:158226905-158226927 CTCTCAGGACACCTCGAAAGGGG + Intergenic
1020798669 7:12706453-12706475 TCCTCATGACAACTCTAAAGGGG - Intergenic
1021587780 7:22228291-22228313 TTACCGGCACATCTATAAAGTGG + Intronic
1021689787 7:23220912-23220934 CTCACAGGACATCTCAAGAGAGG + Intergenic
1023779220 7:43640561-43640583 TTCCCAGGATACCTCTGAAAGGG + Exonic
1029270165 7:99372857-99372879 TTCCCTGGGCATCTACAAAGCGG + Intronic
1030941582 7:115657400-115657422 TTCCCATGACCTCTTAAAAGAGG - Intergenic
1035797821 8:2375725-2375747 TTCCAATGACCTCTCTATAGGGG - Intergenic
1035861199 8:3029713-3029735 TTCCCAGGACATCTGTAGTGAGG - Intronic
1037427225 8:18769149-18769171 TCCCCAGAACATATCTAAAAAGG - Intronic
1038980139 8:32750792-32750814 CTCGCAGAACATCTCCAAAGAGG + Intronic
1039622848 8:39015234-39015256 TTCCCAGTATATCCATAAAGTGG - Intronic
1040885890 8:52263412-52263434 TTCACAGAACATCTCTGAAAAGG + Intronic
1041720427 8:60970338-60970360 TTCCCAGGACATTAGTGAAGAGG - Intergenic
1041729513 8:61050690-61050712 CTCCCAGGTAATCTCAAAAGTGG - Intergenic
1050823461 9:9913757-9913779 TTCCCAGCAATTCTCTAAACTGG - Intronic
1053604706 9:39645413-39645435 TTTCAAGGACATCTCCAAATTGG + Intergenic
1053862521 9:42401424-42401446 TTTCAAGGACATCTCCAAATTGG + Intergenic
1054161029 9:61672144-61672166 TTTACAGGACACCTGTAAAGAGG + Intergenic
1054248836 9:62697003-62697025 TTTCAAGGACATCTCCAAATTGG - Intergenic
1054562947 9:66731529-66731551 TTTCAAGGACATCTCCAAATTGG - Intergenic
1055379499 9:75690502-75690524 TTCCCAGGATATTTCTAACTAGG - Intergenic
1055980284 9:81994190-81994212 TTCCCAGGGCATCTCGAGTGGGG + Exonic
1058173226 9:101707810-101707832 TTCCCAGGACAATTCTGAAAGGG - Intronic
1058221009 9:102302409-102302431 TTCCCAGTACATTTTTGAAGTGG - Intergenic
1062305197 9:135902090-135902112 TTCTCAGGACACCTCTGCAGAGG + Intronic
1203341369 Un_KI270418v1:1940-1962 TTCCAAGGAAATCTTCAAAGAGG + Intergenic
1203341230 Un_KI270419v1:867-889 TTCCAAGGAAATCTTCAAAGAGG - Intergenic
1203341838 Un_KI270422v1:1257-1279 TTCCAAGGAAATCTTCAAAGAGG + Intergenic
1185878309 X:3717727-3717749 TTCCCAGGGCATCTGGAAAGGGG + Intergenic
1186824339 X:13323592-13323614 TTACCAGGATATCTCAAAATAGG - Intergenic
1187179561 X:16930946-16930968 TTCCCAGAAGCACTCTAAAGTGG + Intergenic
1187900672 X:24025043-24025065 TTCCCAGGACTTATCCAGAGGGG - Exonic
1189418343 X:40833884-40833906 CTCACAGGGCAACTCTAAAGAGG + Intergenic
1191383858 X:60039460-60039482 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1191439658 X:60787041-60787063 TTCCAAGGACATCTTCAAAGAGG - Intergenic
1191480092 X:61328077-61328099 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1191517013 X:61822296-61822318 TTCCAAAGACATCTTCAAAGAGG - Intergenic
1192092988 X:68180881-68180903 TTCTCAGAACATCTCTCAAATGG + Intronic
1192349061 X:70340422-70340444 TTTCCAGGATTTCTCTAAATGGG - Intronic
1196942292 X:120789025-120789047 TTGCCAGGAGATTTCTGAAGAGG - Intergenic
1199850002 X:151718934-151718956 TTCCCAGGAAACCTCTAACCTGG - Intronic