ID: 910258826

View in Genome Browser
Species Human (GRCh38)
Location 1:85276601-85276623
Sequence CTGAGCCTCTACGAGAGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910258826_910258832 2 Left 910258826 1:85276601-85276623 CCTTCCCTCTCGTAGAGGCTCAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 910258832 1:85276626-85276648 GCAGGCACCGCCCCACGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 126
910258826_910258831 -3 Left 910258826 1:85276601-85276623 CCTTCCCTCTCGTAGAGGCTCAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 910258831 1:85276621-85276643 CAGGCGCAGGCACCGCCCCACGG 0: 1
1: 0
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910258826 Original CRISPR CTGAGCCTCTACGAGAGGGA AGG (reversed) Exonic
900461514 1:2804255-2804277 CAGAGGCTCCTCGAGAGGGACGG + Intergenic
901164550 1:7208692-7208714 CTGAGCCTTGAAGAGTGGGAAGG + Intronic
902338999 1:15770528-15770550 CAGAGCTTCTACCAGAAGGATGG + Exonic
903170302 1:21548250-21548272 AGGAGCCTCTGCGAGGGGGAGGG + Intronic
904004597 1:27357146-27357168 CTGAGCCTCAACTAGAGGCAGGG + Intronic
906659647 1:47573329-47573351 CTGAGACTCTGAGGGAGGGAGGG - Intergenic
910258826 1:85276601-85276623 CTGAGCCTCTACGAGAGGGAAGG - Exonic
910449986 1:87335005-87335027 ATTGGCCTCTAAGAGAGGGAGGG + Intronic
912179710 1:107204998-107205020 CTGAGGCTCTGGCAGAGGGAAGG - Intronic
913399960 1:118421021-118421043 CTGAGCCTTTAGGAGAGCAAAGG - Intergenic
919787017 1:201264742-201264764 TTGACCCTCTCCGACAGGGATGG - Intergenic
923491403 1:234487282-234487304 CTAAGGCTCTAAGAAAGGGAAGG + Intergenic
1070839749 10:79475880-79475902 CTGAACCTCTATGAAAGGAAAGG + Intergenic
1071706594 10:88006221-88006243 CTGAGCCTCTTTGTGAGGAATGG + Intergenic
1075608566 10:123833861-123833883 AGGACCCTCTACGAAAGGGAAGG + Intronic
1076026774 10:127122181-127122203 CAGAGCCACTAGGAGAGGGTGGG - Intronic
1076499206 10:130922989-130923011 CTGAACCTCTACTCCAGGGAAGG - Intergenic
1076904830 10:133356578-133356600 CTGAGCCTCCAGGAGACAGAGGG + Intronic
1078417154 11:11175227-11175249 CTGATCCTCTGAGAGAGGGACGG - Intergenic
1085782942 11:79425729-79425751 CAGAGCTTATACCAGAGGGATGG - Intronic
1087301691 11:96443435-96443457 CTGGCCCTCTCCCAGAGGGAAGG + Intronic
1089707925 11:120293987-120294009 CTGAGCCTCTGTGAGATGGAAGG + Intronic
1089952804 11:122546104-122546126 GGGAGCCTCTATCAGAGGGAAGG + Intergenic
1090142216 11:124277303-124277325 CAGAGCCTCTGAGAGAGAGATGG - Intergenic
1092143909 12:6201547-6201569 CTCAGCCTCTACAAATGGGAAGG + Intronic
1092890836 12:12967877-12967899 CTCATCCTCTGAGAGAGGGAAGG + Intergenic
1096056186 12:48654350-48654372 CTGAGCCTCTTCCAATGGGATGG + Intronic
1096737516 12:53667371-53667393 CTGAGTCTCTAGAACAGGGAAGG + Intronic
1096984203 12:55745558-55745580 CTGAGCTCTTAAGAGAGGGAGGG + Intronic
1098418463 12:70264448-70264470 CTGAGCCACTACCAGTGGGCAGG + Intronic
1103560947 12:121793151-121793173 CTGAACCTCTACGACACGGCCGG - Exonic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106547921 13:30746322-30746344 CTCAACCTCCATGAGAGGGAAGG + Intronic
1113749655 13:112768368-112768390 CTGAGACTCCACCATAGGGATGG - Intronic
1113880005 13:113619748-113619770 CTGAGTCTCTACGGGACAGAGGG - Intronic
1114263371 14:21055794-21055816 CTGAGCCTCTCCCATTGGGATGG - Intronic
1118844349 14:69535479-69535501 CTGAGCCTCTGGGAGACGGCGGG + Intergenic
1121562300 14:94884587-94884609 CTGGGCCTCCAAGAGAGGGAGGG + Intergenic
1123006531 14:105326493-105326515 CTGAGCACCAAGGAGAGGGATGG + Intronic
1124380339 15:29160053-29160075 CTGAGCCTTGCCCAGAGGGAAGG + Intronic
1125727030 15:41873401-41873423 CCGTGCCTCTGAGAGAGGGAGGG + Intronic
1129851308 15:78795483-78795505 CTGAGGCTCAAAGAGAGGAAGGG - Intronic
1130469730 15:84215718-84215740 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130477218 15:84330280-84330302 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130494547 15:84457850-84457872 TTGAGCCTCTAGGAAAGGAAAGG - Intergenic
1130592020 15:85220346-85220368 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1133008669 16:2898235-2898257 CTGAGACTCCAGCAGAGGGATGG - Intronic
1134800364 16:17078751-17078773 TTTAGCCTCAACGAGAGAGAGGG - Intergenic
1134916036 16:18071968-18071990 CTGAGCCTCTGCCTGTGGGAAGG - Intergenic
1140244289 16:73234107-73234129 ATGTGTCTCTCCGAGAGGGAGGG + Intergenic
1143889651 17:10092873-10092895 CTGTGCCTCTGAGAGAGAGAGGG - Intronic
1144409033 17:14981990-14982012 ATGATCATCTAAGAGAGGGAAGG + Intergenic
1146656332 17:34637310-34637332 CTCAGCCACTACCAGAGGGAAGG - Exonic
1148173094 17:45540116-45540138 GTGAGACTCTAGGAGAGGTATGG - Intergenic
1148276175 17:46305334-46305356 GTGAGACTCTAGGAGAGGTATGG + Intronic
1148298292 17:46522909-46522931 GTGAGACTCTAGGAGAGGTATGG + Intronic
1148362832 17:47027376-47027398 GTGAGACTCTAGGAGAGGTATGG + Intronic
1148697219 17:49567837-49567859 CTGAGCTTCTACTGGGGGGATGG - Intergenic
1149662163 17:58339671-58339693 CTGGGCCTCTAAGAGAGAGCTGG - Intergenic
1150404299 17:64887039-64887061 GTGAGACTCTAGGAGAGGTATGG - Intronic
1150967742 17:69990786-69990808 TTCATCTTCTACGAGAGGGATGG + Intergenic
1152236271 17:79140569-79140591 CTGAGGCTCAAAGAGAGAGAAGG + Intronic
1155737065 18:29237397-29237419 CTCAGGCTCTACAAGAAGGATGG + Intergenic
1155737073 18:29237471-29237493 CTCAGGCTCTACAAGAAGGATGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157393927 18:47326216-47326238 CTGAGCCACTGAAAGAGGGAAGG + Intergenic
1158105611 18:53882431-53882453 CTGAGCGTCTAGGGGAGGGGTGG - Intergenic
1158650699 18:59282348-59282370 CTGAGCAGCCACGATAGGGAGGG - Intronic
1161243139 19:3234073-3234095 CTGACCCTCCACTAGGGGGAAGG + Intronic
1167069986 19:47215805-47215827 CTCATCCTCTACCAAAGGGATGG - Intergenic
1167981253 19:53277540-53277562 CTGAGCGACTGCTAGAGGGAAGG + Intergenic
925185858 2:1845937-1845959 CTGAGCCACTGCATGAGGGATGG - Intronic
925842630 2:8006760-8006782 GTGAGCCTCTACCTGAGTGATGG - Intergenic
928220336 2:29398094-29398116 CTGAGCCTGCATGAGAGGCAGGG + Intronic
929920652 2:46169016-46169038 CTGAGCCCCTCTGTGAGGGAGGG - Intronic
934325653 2:92012104-92012126 CTCAGCCTCTACGAGTGGCTGGG - Intergenic
934464006 2:94242722-94242744 CTCAGCCTCTACGAGTGGCTGGG - Intergenic
936762950 2:115808408-115808430 CTCAGCTTCTACAAGAGGAATGG + Intronic
942644027 2:178091589-178091611 CTGAGTCTGTACCAAAGGGATGG - Intronic
948571083 2:238917356-238917378 CTGAGCCCCAACCAGAGGGGAGG + Intergenic
948850290 2:240702333-240702355 AGGAGGCTCTACGAGAGGGTAGG - Intergenic
1168829987 20:840647-840669 CTCAGCCTGTTCCAGAGGGATGG + Intronic
1170736475 20:19017600-19017622 CTGAGCCTCTAGGAGAGGAGGGG - Intergenic
1172697658 20:36833519-36833541 CTGATCCTCAGGGAGAGGGATGG + Intronic
1175962181 20:62642704-62642726 CCGAGCCTCTCCGCGGGGGAGGG + Intronic
1179092432 21:38279163-38279185 CTGAGGGTCTACGGGAGGAAGGG + Intronic
1181627292 22:24130602-24130624 CTGAACCTCTGCAAGGGGGAAGG - Intronic
1182270368 22:29149517-29149539 AAGAGCCTCTAGGAGAGAGAAGG - Intronic
1182302123 22:29342822-29342844 CTGTGCTTCTACCAGAGGGTTGG + Intronic
1182393833 22:30021031-30021053 ATGAGCCTCCACGACAGCGATGG + Intronic
955086851 3:55710889-55710911 CTGAGGCTCCAAGAGGGGGAAGG + Intronic
956901952 3:73726191-73726213 TTGAGCCTCCAGGGGAGGGATGG + Intergenic
957071708 3:75572558-75572580 CTGCTGGTCTACGAGAGGGATGG - Intergenic
961728107 3:128945968-128945990 CACAGCCTCTACGAGAGAGCAGG + Exonic
963851886 3:150217580-150217602 ATGATCCTCTCCTAGAGGGATGG + Intergenic
968569051 4:1329792-1329814 CTGAGGCTGGACAAGAGGGAAGG + Intronic
970065251 4:12086328-12086350 CTGTGGCTCTACAAGAGAGAAGG - Intergenic
971593339 4:28497159-28497181 CTAGGCCTCTACGAGGGGAAAGG - Intergenic
974499731 4:62684338-62684360 CTGAGCCTCTAAGGGAGGGTTGG + Intergenic
974784019 4:66594029-66594051 CTGAGATTCTGCTAGAGGGAAGG - Intergenic
979040670 4:115789135-115789157 CAGAGCCTCAAAAAGAGGGAAGG + Intergenic
986745420 5:10739662-10739684 CTAAGCCACTACAAGTGGGAAGG + Intronic
987898335 5:23978212-23978234 TTGAGCCTCTAGGAAAGGAAAGG + Intronic
989704147 5:44307938-44307960 CTGAGCTTCTACCAGAGGTTAGG + Intronic
990327905 5:54696305-54696327 CTGAGGCTGTGCGAGAGGCATGG - Intergenic
990408972 5:55521399-55521421 CTCAGCCTCCACGAGTGGCAAGG - Intronic
995174524 5:109159811-109159833 CAGAGCCTCTATGAGAGGCCTGG - Intronic
995730115 5:115229819-115229841 CTGAGTCTCTATGAGATGGAGGG - Intronic
996675734 5:126172420-126172442 CTGAGCCCCTAGGGGAGGGCTGG + Intergenic
1001263097 5:170249664-170249686 CTGAGCCTTTATGAGTGTGAAGG - Intronic
1002601155 5:180354467-180354489 CTGAGGCTCCACGACAGCGAAGG + Intergenic
1003845609 6:10171141-10171163 TGGAGCCTCTAAGAGAGGAACGG + Intronic
1005040428 6:21595498-21595520 CTGGGCCTGTACGAGGAGGAGGG + Exonic
1013092286 6:106911206-106911228 CTGAGCTGCAACTAGAGGGACGG - Intergenic
1017327068 6:153151915-153151937 CTGAGCCTTTACCATAAGGAAGG + Intergenic
1018995813 6:168709752-168709774 CTCAGCCTCTGCGGGAGGGCAGG - Intergenic
1019924319 7:4182246-4182268 CTGAGCCCCGCCTAGAGGGAGGG - Intronic
1023270997 7:38462621-38462643 CTAAACCACTAGGAGAGGGAAGG + Intronic
1024974675 7:55102169-55102191 CTGAGGCTCTGGGTGAGGGAAGG - Intronic
1026630471 7:72033562-72033584 GTGAGCCTTTAAAAGAGGGAAGG + Intronic
1035491730 7:159285029-159285051 CTGAGCCCCTAGGGGAGGGGTGG + Intergenic
1037783487 8:21887546-21887568 CTGGGCCTCCAGGTGAGGGAAGG - Intergenic
1041004583 8:53486164-53486186 CTGAGCCTTTACCATAAGGAAGG + Intergenic
1048281092 8:133106177-133106199 CTGAGCCTCAGAGAGATGGAGGG + Intronic
1053694097 9:40619532-40619554 CTCAGCCTCTACGAGTGGCTGGG - Intergenic
1054270738 9:63020595-63020617 CTCAGCCTCTACGAGTGGCTGGG + Intergenic
1054305342 9:63418756-63418778 CTCAGCCTCTACGAGTGGCTGGG - Intergenic
1054404088 9:64742745-64742767 CTCAGCCTCTACGAGTGGCTGGG - Intergenic
1054437710 9:65228245-65228267 CTCAGCCTCTACGAGTGGCTGGG - Intergenic
1054492693 9:65793722-65793744 CTCAGCCTCTACGAGTGGCTGGG + Intergenic
1057082425 9:92182746-92182768 CTCATCCTCTGCTAGAGGGAAGG + Intergenic
1062627297 9:137449113-137449135 CTGAGCCTCCAGGCGAGGCATGG + Exonic
1189292340 X:39895249-39895271 CTGAGCCTCAGCGAGGGAGAAGG - Intergenic
1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG + Intronic
1197147344 X:123184812-123184834 CTGAGCCTCAACGAGGTGGCTGG + Intronic