ID: 910264021

View in Genome Browser
Species Human (GRCh38)
Location 1:85319699-85319721
Sequence ATTCACAGGATGCACATAAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910264019_910264021 -9 Left 910264019 1:85319685-85319707 CCAAGACGTGGTTTATTCACAGG 0: 1
1: 0
2: 2
3: 6
4: 69
Right 910264021 1:85319699-85319721 ATTCACAGGATGCACATAATTGG 0: 1
1: 0
2: 1
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910264021 Original CRISPR ATTCACAGGATGCACATAAT TGG Exonic
904422369 1:30402525-30402547 ATTCACAGGATGAATTAAATGGG - Intergenic
905613893 1:39380329-39380351 ACTCACAGGAAGCAGAAAATTGG + Exonic
907270125 1:53286200-53286222 ATCCACAGGAAGCACAGCATGGG + Intronic
910264021 1:85319699-85319721 ATTCACAGGATGCACATAATTGG + Exonic
910788358 1:91024495-91024517 GTACACAGGAAGCACATCATGGG + Intergenic
913203709 1:116516885-116516907 ATTCAGAGAAAGCATATAATAGG - Intronic
917619133 1:176777691-176777713 ATTTACAGGATAGAAATAATAGG + Intronic
918613671 1:186520234-186520256 ATTATCAGGGTGCACATAAAGGG + Intergenic
920450520 1:206057714-206057736 TTTCACAGGAAGCACAGACTGGG - Intronic
922966964 1:229698564-229698586 ATTAACAAGATTCACCTAATAGG - Intergenic
1064061161 10:12138556-12138578 AGTCACAGGATGCAGATGAGTGG - Intronic
1064223855 10:13465088-13465110 ATTCACTGCTGGCACATAATAGG + Intronic
1065404380 10:25347449-25347471 ATTCACAGGCTGCACAGATTAGG + Intronic
1065708693 10:28494900-28494922 ATCCATAGAATGCACATATTGGG + Intergenic
1066798977 10:39162282-39162304 ATTCACAGAATGGACAAAAATGG - Intergenic
1066929698 10:41741817-41741839 ATTCACAGATTGCACAAAAATGG - Intergenic
1066930967 10:41758134-41758156 ATTCACAGAATGGACAAAAACGG - Intergenic
1066931737 10:41770262-41770284 ATTCACAGAATGGACAAAAATGG - Intergenic
1068746855 10:60542152-60542174 ATTCACAGGAAGGAGATAAAAGG - Intronic
1079976073 11:27093160-27093182 ATTCACAGAATGCCAATACTGGG + Exonic
1080857765 11:36126898-36126920 GTTCACAGGATGCACTTGCTCGG - Intronic
1081305197 11:41503239-41503261 ATTCACATGAAGCAAATAGTAGG - Intergenic
1082302344 11:50523628-50523650 ATTCACAGAATGGATAAAATTGG - Intergenic
1082308693 11:50617447-50617469 ATTCACAGAATGGACAAAAACGG + Intergenic
1082309323 11:50627551-50627573 ATTCGCAGAATGGACATAAACGG - Intergenic
1082573713 11:54776088-54776110 ATTCACAGAATGGACAAAAACGG - Intergenic
1087659070 11:100964536-100964558 ACTCATAGGATTCACATTATGGG - Intronic
1089149214 11:116351905-116351927 AATCCCAGGATGCACACAAATGG + Intergenic
1091382350 12:70059-70081 ATTCACAGGAAACCCATGATTGG - Intronic
1092927586 12:13285921-13285943 ATTCACAATATCCACAGAATCGG + Intergenic
1095079332 12:37979237-37979259 ATTCTCAGAATGCACAAAAACGG - Intergenic
1095738080 12:45579712-45579734 ATTCACAGGGTACAAGTAATAGG + Intergenic
1096560919 12:52435266-52435288 AGTCACAGGATGGACATGGTTGG - Intergenic
1096756784 12:53806199-53806221 ATTCAGTGGATCCACATAACGGG + Intergenic
1097637324 12:62138690-62138712 ACTCACAGGCTGCATTTAATTGG - Intronic
1099077305 12:78126285-78126307 ATACACAGGATACGCATAATGGG - Intronic
1099616736 12:84945013-84945035 AATCATAGGATGCTCAAAATAGG - Intergenic
1101064670 12:101007411-101007433 ATACACATGATGCTCATAAATGG - Intronic
1101935747 12:109054980-109055002 ATTCACATGATCCAAATACTGGG + Intronic
1103013231 12:117474043-117474065 AGCAACAGGATGCACCTAATTGG + Intronic
1104382372 12:128318702-128318724 ATTGACAGGAGACACTTAATTGG + Intronic
1106856617 13:33860494-33860516 AGTCACAGGATGCACATTGGAGG - Intronic
1108831337 13:54482999-54483021 ATTAACAGGATGTACAGAATCGG - Intergenic
1110452568 13:75653365-75653387 ATTCACAGAATGGACATCATTGG - Intronic
1112029627 13:95445223-95445245 AGGAACAGGAAGCACATAATTGG + Intronic
1112434381 13:99381242-99381264 ATCCACAGGATGCTGATAATGGG - Intronic
1114082261 14:19211216-19211238 ATTCCCAGGATGCACAGGGTGGG - Intergenic
1116547611 14:46189303-46189325 ATACACAGGAAGCACATTATTGG + Intergenic
1119176407 14:72570785-72570807 ATTCACAAGTTCCAAATAATTGG + Intergenic
1121654626 14:95586290-95586312 ATTCACAGGTTCCAGATATTAGG - Intergenic
1121906277 14:97749307-97749329 CTTAACATGATGCATATAATAGG - Exonic
1122759161 14:104008405-104008427 ATTTAAAGGATGAACTTAATTGG + Exonic
1125593713 15:40871737-40871759 ATTCACAGCCTGAACATAAAGGG - Intergenic
1125902795 15:43364447-43364469 ATTCTCATGATGCAGATGATAGG - Intronic
1129057209 15:72829074-72829096 ACTCCCAGGAAGCACAAAATAGG + Intergenic
1131918598 15:97298415-97298437 TCTCATAGGAAGCACATAATTGG + Intergenic
1132974111 16:2703000-2703022 ATTCTCAGGCTGCACAGAGTAGG + Intronic
1133878341 16:9756785-9756807 ATTCCAAGAATGCACAGAATGGG + Intronic
1133899976 16:9964857-9964879 ATTCACAGCATGGACATCTTAGG + Intronic
1134170574 16:11965518-11965540 ATTCAGAGAATCAACATAATGGG + Intronic
1136740513 16:32518576-32518598 ATTCACAGAATGGACACAAACGG + Intergenic
1136741502 16:32534103-32534125 ATTCACAGAATGGACAAAAAAGG + Intergenic
1137030562 16:35520018-35520040 ATTAACAGAAAGCACATAAAAGG - Intergenic
1140183502 16:72745098-72745120 AGACACAGGATGCAAATATTTGG + Intergenic
1140934956 16:79661881-79661903 AATCACAGGGTCCACATAAGAGG - Intergenic
1141003738 16:80332829-80332851 AGTAACAGGATGCAAATACTGGG + Intergenic
1203028100 16_KI270728v1_random:541131-541153 ATTCACAGAATGGACAAAAAAGG - Intergenic
1203029093 16_KI270728v1_random:556658-556680 ATTCACAGAATGGACACAAATGG - Intergenic
1203042628 16_KI270728v1_random:777773-777795 ATTCACAGAATGGACACAAATGG + Intergenic
1203043621 16_KI270728v1_random:793300-793322 ATTCACAGAATGGACAAAAAAGG + Intergenic
1142845694 17:2674075-2674097 ATTCACAGGACACAGAGAATGGG + Exonic
1149390942 17:56189714-56189736 ATTCACAGGTTTCAGATATTAGG + Intronic
1150780779 17:68120103-68120125 GGTCACAGGGTGCACATCATAGG + Intergenic
1156615656 18:38781758-38781780 AGTAACAGGATGCAGATAAGTGG + Intergenic
1156647828 18:39187879-39187901 TTTCACAATATGAACATAATGGG + Intergenic
1157982694 18:52400187-52400209 ATTGACAGGATGAACATACTGGG - Intronic
1158735466 18:60074701-60074723 ATCCACAGGATCCACATTAATGG + Intergenic
1158947610 18:62460808-62460830 ATTCATAGGATGGAGATTATTGG + Intergenic
1159950077 18:74476478-74476500 ATTCACAGGTTACAGATATTAGG - Intergenic
1165506963 19:36239208-36239230 ATGCACAGGCTTCATATAATTGG + Intronic
1168616912 19:57845474-57845496 ATTAACAGGAGGAACAGAATAGG + Exonic
927910069 2:26891207-26891229 AATCAGATGATGCACACAATGGG + Intronic
928159255 2:28907015-28907037 ATTCAGAGGAGGGACATACTAGG + Intronic
929373216 2:41252187-41252209 ATGCTCAGGGTCCACATAATTGG + Intergenic
930537473 2:52661643-52661665 ATACACAGGTTGCCAATAATAGG + Intergenic
935751988 2:106243663-106243685 ATCCACATGTTGCACATAATAGG + Intergenic
935912398 2:107911210-107911232 ATCCACATGTTGCACATAATAGG + Intergenic
938472106 2:131574499-131574521 ATTCTCAGCTTGCACATTATTGG + Intergenic
941118818 2:161504773-161504795 CTTCAAGGGAGGCACATAATTGG + Intronic
941207269 2:162589586-162589608 AATCATAGGATGCACAGAAGGGG + Intronic
942030540 2:171954758-171954780 ATTCACAGGTTCCAGATATTAGG - Intronic
942195145 2:173509775-173509797 AAGTACAGAATGCACATAATAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947071196 2:226289706-226289728 ATTAAGAGGATGAACATATTAGG - Intergenic
948409961 2:237751722-237751744 TTTTACAGGGTGCAAATAATTGG - Intronic
1170880174 20:20290036-20290058 AATCACAGGATACACAAGATCGG + Intronic
1170912792 20:20591634-20591656 ATTCAGGAGATGCACAGAATGGG + Intronic
1176282850 20:64324774-64324796 ATTCACAGGAAACCCATGATCGG + Intergenic
1177811595 21:25930430-25930452 CTTCAAAGGATGCAAAGAATTGG + Intronic
1178868136 21:36347522-36347544 ATCCACAGAATGCAAATACTAGG - Intronic
1180028161 21:45180686-45180708 ATTCACAGGATGAAGATGACAGG - Intronic
1180153157 21:45962785-45962807 AGACACAGGAGGCAGATAATGGG - Intergenic
1180472582 22:15674129-15674151 ATTCTCAGCTTGCACATCATTGG + Intergenic
1180498514 22:15911454-15911476 ATTCCCAGGATGCACAGGGTGGG + Intergenic
1183134512 22:35873602-35873624 ACTCACAGGATGTAAAAAATTGG - Intronic
949096298 3:89825-89847 AATCAGAGGATATACATAATTGG + Intergenic
951073967 3:18366805-18366827 ATTTACAGGTGGCATATAATGGG - Intronic
951878201 3:27452549-27452571 TTTCAAAGGATGCATATAATAGG - Intronic
955980095 3:64516172-64516194 AGACACAGGATGCACAGAATGGG - Exonic
956090758 3:65664169-65664191 TTTCACAGAATGCTCATAACAGG + Intronic
956546143 3:70405561-70405583 ATTCACAGAATGGGCTTAATAGG + Intergenic
959729373 3:109583543-109583565 ATTCTCAGCATGAAGATAATAGG - Intergenic
966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG + Intronic
967433756 3:189420289-189420311 AGTCACAGGAGGCAAATAAGAGG - Intergenic
970076740 4:12230756-12230778 ATTCACTGGAAGCCCATGATAGG - Intergenic
970172450 4:13303423-13303445 ATTGACAAGATGCACACAAGTGG - Intergenic
971829903 4:31678019-31678041 TTTCAAACTATGCACATAATTGG + Intergenic
974352355 4:60765591-60765613 ATTCAGAGGGTGCACACAAAAGG + Intergenic
978350764 4:107818528-107818550 ATTCACAGGTTCCACAGATTAGG - Intergenic
980396389 4:132221616-132221638 ACACACGGGATGCAAATAATTGG + Intergenic
980468874 4:133223861-133223883 ATTCTCAGGATGCAATTAAAAGG - Intergenic
982639140 4:157934819-157934841 ATTCACAGGATCTATCTAATAGG - Intergenic
983125601 4:163947474-163947496 AATCACAGGGTCCACATAAGAGG + Intronic
983380666 4:166988649-166988671 ATTCATAGGCAGCAGATAATGGG + Intronic
983745278 4:171190532-171190554 ATTCACAGGTTGCAGGAAATAGG + Intergenic
984907376 4:184641412-184641434 ATACACAGACTGCAAATAATGGG + Intronic
985479939 5:103214-103236 CTTCACAGGATGCACCTGGTGGG - Intergenic
987212839 5:15701546-15701568 ATTTACTGGATACATATAATGGG + Intronic
989709712 5:44383089-44383111 ATTCACAGGCAGCTCATAAATGG + Intronic
989845698 5:46137804-46137826 ATTCACAGAATGGACAAAAAAGG - Intergenic
989851845 5:46222965-46222987 ATTCACAGAATGGACAAAAATGG - Intergenic
990624259 5:57593903-57593925 CTTCACAGGCTGCACATAATAGG - Intergenic
994371654 5:98974659-98974681 AGTAACAGGATACTCATAATGGG + Intergenic
995216520 5:109601492-109601514 ATTCAAAGCAAGCACAAAATAGG - Intergenic
997229434 5:132231931-132231953 ATTCACAGGATCCAGGTAGTAGG + Intronic
997702619 5:135913985-135914007 ACAAACAGGATGCACATAAATGG - Intergenic
998703765 5:144735093-144735115 ATTCTCAGCATGAACATTATTGG + Intergenic
999738679 5:154532553-154532575 TCTCACAGGATGCATCTAATTGG - Intergenic
1000313461 5:160066640-160066662 ATTGATAGAATGCACATAAATGG - Intronic
1000760730 5:165221125-165221147 ATTCACTGGATGGACTAAATAGG - Intergenic
1001094908 5:168768464-168768486 AATCACTGGATGCCCATACTCGG + Intronic
1002699837 5:181115016-181115038 ATTCACGGCATGAACATACTTGG - Intergenic
1004268822 6:14175624-14175646 ATTCACAGGTTGCAGGTACTAGG - Intergenic
1005520022 6:26592548-26592570 ATTCCCAGGAGGCAAATATTGGG + Intergenic
1006857174 6:37142658-37142680 ATTCACAGGGTGCTCACCATAGG + Intergenic
1008394524 6:50991149-50991171 ATTCTCAGCATGGACATAGTTGG - Intergenic
1009064074 6:58435379-58435401 ATTCACAGAATGGACAAAAACGG - Intergenic
1009251096 6:61299977-61299999 ACTCACAGAATGCACAAAAACGG + Intergenic
1009260061 6:61474829-61474851 ATTCACAGAATGGACAAAAACGG - Intergenic
1009261844 6:61500805-61500827 ATTCACAGAATGGACAAAAGCGG + Intergenic
1011130038 6:84043339-84043361 ATTCAGATAATCCACATAATGGG + Intronic
1012054697 6:94391640-94391662 CTTCACTTGAGGCACATAATGGG - Intergenic
1014544345 6:122715576-122715598 ATACAACTGATGCACATAATTGG - Intronic
1017939742 6:159041278-159041300 ATTCTCAGGATGCAAGAAATAGG - Intronic
1018098561 6:160415675-160415697 ATTCTCAGGGTGCCCATTATAGG + Intronic
1018567441 6:165169572-165169594 ATTAACAGGATGGATATAGTGGG + Intergenic
1022514704 7:30968211-30968233 ATTCACAGGTTCCACAGATTAGG + Intronic
1022706062 7:32802904-32802926 ATTCACAGGAAGCAGAAATTTGG - Intergenic
1025526496 7:61819249-61819271 ATTCACAGAATGCACAAAAAAGG - Intergenic
1025549872 7:62231805-62231827 ATTCACAGAATGCACAAAAAAGG - Intergenic
1025584071 7:62759542-62759564 ATTCACAGAATGGACAAAAACGG - Intergenic
1025587471 7:62809600-62809622 ATTCACAGAATGGACAAAAACGG + Intergenic
1026387899 7:69869235-69869257 ATTCACAAAATGCACATTATAGG - Intronic
1028361233 7:89969338-89969360 AGTTAAAGGATGCACAGAATTGG - Intergenic
1029035336 7:97513988-97514010 ATGCACAGAATGCACAGAAGGGG - Intergenic
1032919240 7:136527284-136527306 ATTCAGAGGAGACACAGAATGGG + Intergenic
1037424305 8:18738452-18738474 ATTCACAGTATAAACATCATAGG - Intronic
1039143762 8:34422165-34422187 TTTCTCAGCATGCACATAATTGG + Intergenic
1043888104 8:85625669-85625691 ATTGCCTGGATGCACATTATAGG + Intergenic
1049121043 8:140738144-140738166 ATTCACAGGATCAACATGAGTGG + Intronic
1056449792 9:86705831-86705853 ATTCACACGATGCACTTAAGAGG - Intergenic
1056712131 9:88999635-88999657 ATTCACTGGATACACACAGTAGG + Exonic
1187509163 X:19902044-19902066 ATTCACAGGCTCCACAGATTAGG - Intergenic
1188617033 X:32170104-32170126 AGTTACAGCATGCACATAATGGG - Intronic
1188983102 X:36745520-36745542 TTTAATAGGTTGCACATAATAGG - Intergenic
1191267107 X:58408249-58408271 ATTCACAGAATGGACAAAACAGG + Intergenic
1191268269 X:58426469-58426491 ATTCGCAGAATGGACATAAATGG + Intergenic
1191721817 X:64237120-64237142 AATCACAAGATTCACACAATAGG + Intergenic
1194046749 X:89016077-89016099 ATTCACAACAAGGACATAATAGG - Intergenic
1194682882 X:96875584-96875606 TTTCAGAGGATGAAAATAATAGG - Intronic
1195265713 X:103177665-103177687 ATTCACAGAGTGTAGATAATAGG - Intergenic
1201467633 Y:14301576-14301598 TTGCACAGGATGCCCTTAATTGG - Intergenic