ID: 910265693

View in Genome Browser
Species Human (GRCh38)
Location 1:85334651-85334673
Sequence CTCAGGAAACCTAATCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 19, 2: 70, 3: 75, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910265693 Original CRISPR CTCAGGAAACCTAATCATGG TGG (reversed) Intronic
900760775 1:4468697-4468719 CTCAGGAGACCAAGTCATGATGG - Intergenic
901051304 1:6427072-6427094 CTCAGGAAGTCAAATCACGGTGG - Intronic
902645042 1:17792014-17792036 ATCAGGAACCCTTATCATTGGGG + Intronic
902972220 1:20062083-20062105 CTCAGGAAGCTTAGTCATAGTGG - Intronic
904823342 1:33258733-33258755 CTCAGGAAAGATTATGATGGCGG - Intronic
905263096 1:36732911-36732933 CTCATGAAACCTCATAAGGGAGG - Intergenic
905688053 1:39922852-39922874 CTCAGTAAACTTATTCGTGGAGG + Intergenic
905698159 1:39991255-39991277 CTCAGTAAACTTATTCGTGGAGG + Intergenic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
907633439 1:56107515-56107537 CTCAGGAAACCTGGTCATGAAGG + Intergenic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
910826744 1:91417126-91417148 TTCAGGAAACTTAATAATCGTGG - Intergenic
911104822 1:94121353-94121375 CTCAGGAACCCCTCTCATGGAGG - Intergenic
911445781 1:97990152-97990174 CTCAGGAATGGAAATCATGGTGG + Intergenic
911735373 1:101331172-101331194 CTCAGGAAACTCAATCATGGTGG + Intergenic
911972283 1:104453316-104453338 CTCAGGAAATGTAGTCATGGAGG - Intergenic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
915035333 1:152918942-152918964 ACCAGGAAAACTAAGCATGGGGG - Intergenic
915886518 1:159728185-159728207 CTCAGGAAACACAATCAAGGTGG + Intergenic
916512361 1:165483578-165483600 CTCAGAAAACTTAATCATGGTGG + Intergenic
917608909 1:176666496-176666518 CTCAGAAAACCTCATCTTGTGGG + Intronic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
919165628 1:193887930-193887952 CTCAGGAAACTTAATCGTGGCGG - Intergenic
920950952 1:210571217-210571239 GTCAGGAAAGCTAATGATGTTGG + Intronic
921465218 1:215478674-215478696 CTCAGGAAATTAAATTATGGTGG + Intergenic
922174001 1:223180751-223180773 CTCAGGAAACAAACTCATGCAGG - Intergenic
923059274 1:230455632-230455654 CTGATCAAGCCTAATCATGGTGG + Intergenic
923179026 1:231498414-231498436 ATCAGGAAACACAATCATGGTGG + Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
1062906562 10:1183530-1183552 CACAGGAAACCTAGTCATCAAGG + Intronic
1063129836 10:3168712-3168734 CTCAGGAAACACAATCGTGGTGG - Intronic
1063783085 10:9349441-9349463 CTCAGGAAACTTAATCGTGGTGG + Intergenic
1064039140 10:11943424-11943446 CTCAGGAAACTTCTTCATTGTGG - Intronic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1066128138 10:32362520-32362542 CTTAGGAAACATAGTCATGGTGG - Intronic
1067352950 10:45493584-45493606 CTCTGGACACCTAATCATTTAGG + Intronic
1067843399 10:49699897-49699919 CTCAGGCAACCTGATCTCGGGGG - Intronic
1068944120 10:62711439-62711461 TTCAGGAATCTTAATCATGATGG + Intergenic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1071860624 10:89669047-89669069 CTTAGGGAACTTAGTCATGGCGG + Intergenic
1071921879 10:90359561-90359583 CTTAGGAAACCCAAGCTTGGAGG - Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1072654420 10:97320077-97320099 CTCTGGAAACCTCATCAAGGAGG + Exonic
1074808358 10:117077128-117077150 CTAAGGAAACCTATTCGTAGAGG - Intronic
1077560366 11:3256676-3256698 TTCAGGACACCTCAGCATGGAGG - Intergenic
1077566263 11:3302493-3302515 TTCAGGACACCTCAGCATGGAGG - Intergenic
1078440427 11:11360678-11360700 TTCAGGAAAACTAAACTTGGTGG - Intronic
1078739400 11:14052504-14052526 CTCAGGAACCCTGACCAGGGAGG + Intronic
1078821377 11:14886479-14886501 CTAAGGGAACCTAACCTTGGAGG + Intronic
1080902941 11:36512721-36512743 TTCAGGAAACCTGATCATTGTGG - Intronic
1080986286 11:37470365-37470387 CTCAGGAAACTTAATGATCATGG + Intergenic
1081003145 11:37699734-37699756 CTAAGGAACCATAATCATGGTGG + Intergenic
1082177406 11:49077080-49077102 CTGCAGAAACCTAATCAGGGAGG + Intergenic
1085231663 11:74976844-74976866 GTCATCAAACCTAAGCATGGGGG - Exonic
1086731173 11:90251258-90251280 CTCAGGAAAAATATTCGTGGTGG - Intergenic
1087077278 11:94136932-94136954 CTCGGGAAACACAGTCATGGCGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087708199 11:101519608-101519630 CTCAGAAAAAAAAATCATGGTGG + Intronic
1087939333 11:104076180-104076202 TTCAGGAAACATAATCATGGTGG - Intronic
1089714859 11:120349156-120349178 CTCAAGAATTCTAATCATGCAGG - Intronic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1092940394 12:13402376-13402398 CTCAGGAAACTTAACAATCGTGG - Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1095199352 12:39364413-39364435 CTTAGGAGATATAATCATGGTGG - Intronic
1095487495 12:42700097-42700119 GTAATGTAACCTAATCATGGTGG + Intergenic
1098198355 12:68026628-68026650 CTGAGGAAACAGAATCACGGTGG - Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1100216774 12:92458528-92458550 ATCAGGAAACACAATCATGGTGG + Intergenic
1101955325 12:109207610-109207632 CTCAGGAGAGCAAATCATGATGG + Intronic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1105280773 13:18961419-18961441 CTCTGGAAACCTGAACAGGGTGG + Intergenic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1110715456 13:78698128-78698150 ATGAGGAAACCAAATTATGGTGG - Intergenic
1110827233 13:79986859-79986881 CTAAGGGAACCCAGTCATGGAGG - Intergenic
1111183880 13:84703318-84703340 CTAAGGAAACATATTCTTGGAGG - Intergenic
1111483878 13:88869251-88869273 CTCAGGAAATAAAATCATGGTGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1113499862 13:110764688-110764710 TTCAGGCAACACAATCATGGCGG - Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1116827430 14:49686299-49686321 CTGAGGCAACCTAATCAAGGAGG - Intronic
1118046340 14:61975479-61975501 CTCAGCAAACTTAATCATGATGG + Intergenic
1118369508 14:65125487-65125509 CTCAGGAAACACAATCATAGTGG + Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1120959619 14:90112761-90112783 CTCAGGAAAATTGATCTTGGTGG + Intronic
1121486124 14:94316596-94316618 ATGTGGAAACCTATTCATGGGGG + Intronic
1121943976 14:98101477-98101499 AGCAGGTAACCGAATCATGGGGG + Intergenic
1123411200 15:20061270-20061292 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1123520546 15:21068381-21068403 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1124110189 15:26778087-26778109 CTCAGGAAACATAATCACGGCGG + Intronic
1125069145 15:35531205-35531227 CTTAGAAAACCTGATTATGGTGG - Intronic
1125678895 15:41518258-41518280 CACATGAAACCAAATCATGAGGG + Intronic
1127703976 15:61529099-61529121 CTCTGGAAACCTACTCAAGGCGG + Intergenic
1127744006 15:61945138-61945160 CTCAGGAAACTGAATCATGGTGG - Intronic
1131646914 15:94354537-94354559 CTCAGGAAACTTAATCACCATGG - Intronic
1132035084 15:98476099-98476121 CTCAGGAAAAAAAATAATGGTGG + Intronic
1133697641 16:8280140-8280162 ATAAGGTAACCTAATCATGGAGG - Intergenic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1135800738 16:25492745-25492767 CCAAGGAGACCTAGTCATGGAGG - Intergenic
1138683130 16:58701307-58701329 CTCAGGAAACTTAACAATCGTGG - Intergenic
1140715022 16:77715555-77715577 CTCAGGAAAGGTACACATGGGGG - Intergenic
1143427340 17:6850498-6850520 CTCAGGAAACAAAATCATGATGG + Intergenic
1147557120 17:41486572-41486594 CTGAGGAAACAAAATCATGCAGG + Intronic
1148219762 17:45853177-45853199 CTGAGGACACTTATTCATGGTGG - Intergenic
1148693032 17:49543980-49544002 CTCAGGAAACATAACCATGGTGG + Intergenic
1148925771 17:51083706-51083728 ATCAGGAAAGTTAAACATGGTGG - Intronic
1149031278 17:52085339-52085361 AACAGGAAACATAATCATGCAGG - Intronic
1149050432 17:52297888-52297910 CTCAGGAAACAGAATCACGGTGG - Intergenic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1149401813 17:56304285-56304307 CTCAGGATAACTCATCAGGGTGG + Intronic
1152165821 17:78704915-78704937 CTTAGGAAACAAAGTCATGGGGG + Intronic
1153433698 18:5046382-5046404 CTCAGGAAACTTAACAATTGTGG - Intergenic
1154049094 18:10936443-10936465 CTTAGGAAACCAAAGAATGGAGG + Intronic
1155521946 18:26677242-26677264 GTCAGAAATCCTAATGATGGGGG - Intergenic
1155816733 18:30320828-30320850 TTCAGGAAGCTTCATCATGGTGG + Intergenic
1156615961 18:38784414-38784436 CTCAAAAAACTTAATCATGGTGG + Intergenic
1156804771 18:41164914-41164936 CTCAGGAAAGCTGCCCATGGTGG + Intergenic
1156840183 18:41601749-41601771 TTCAGGACACCTAATCCTGATGG + Intergenic
1157131852 18:45014581-45014603 CTCAGGAAACAAAAACATCGAGG + Intronic
1158107281 18:53899922-53899944 CTCAGGAAACTTAGTCATGATGG - Intergenic
1160745155 19:708149-708171 CCCAGCACACCTACTCATGGGGG - Intergenic
1161340305 19:3738278-3738300 CTCAGATAACCAAATCATGGTGG - Intronic
1161733250 19:5975228-5975250 CTCAGGAAATCAAATCTTGGTGG - Intronic
1162593404 19:11608053-11608075 CTCAGGAAACTTAATCATGACGG + Intronic
1164751572 19:30659227-30659249 CTCAAGAAACTTAGTCATGGTGG + Intronic
1164810316 19:31149872-31149894 CTTATGAAACTTAATCATAGAGG + Intergenic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
1168562434 19:57395495-57395517 CTCAGGAAACACAATCCTGGCGG + Intronic
925053151 2:832874-832896 CTCAGGAAACTTAGTCGTGGGGG - Intergenic
925140020 2:1543888-1543910 CTCTGGAAACACAGTCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
925482272 2:4288921-4288943 CTCAGGAAGCAGGATCATGGCGG + Intergenic
925876578 2:8316458-8316480 CTCAGGAAACTTAACCATCATGG + Intergenic
926170086 2:10547668-10547690 TTCAGGAAAGCTGATGATGGAGG - Intergenic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928403238 2:30994316-30994338 CTCGGGAAACCTGACCAGGGTGG + Intronic
928620295 2:33081924-33081946 CTCAGGAAACTTAACAATCGTGG - Intronic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
929351216 2:40957730-40957752 CTCAGGAAACTGAATCATGGAGG + Intergenic
930521206 2:52469920-52469942 CTCTGGAAACATAATCATGATGG - Intergenic
931808099 2:65827538-65827560 CTTAGGATACCTTATCATGGGGG + Intergenic
932150148 2:69363491-69363513 TTGTGGAAACCTAATAATGGGGG - Intronic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
933864279 2:86501606-86501628 CTCAGGAAACACAGTCGTGGCGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
935506680 2:103913211-103913233 ATCAAAAAACCTATTCATGGTGG - Intergenic
935868689 2:107420903-107420925 CTCAGGAAACACAATCATGATGG + Intergenic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
937761184 2:125604917-125604939 GTGAGGTAACTTAATCATGGGGG + Intergenic
938055327 2:128209904-128209926 CTCAGCAAACCCAGTCATGCTGG - Intergenic
938614568 2:132983967-132983989 CTATGGAAAACTAAGCATGGTGG + Intronic
939147132 2:138429224-138429246 CTCAGGAAACATGATCATAGTGG - Intergenic
940252654 2:151696597-151696619 CTCAGGACACCCAATTATGAGGG - Intronic
942736428 2:179119547-179119569 CTCAGGAAACAGAATCGTGGTGG - Intronic
942795731 2:179816535-179816557 CCCAGGAAGCCTAATCAGGTAGG - Intronic
945774404 2:214086601-214086623 CTCAGGAAACATAATCACGGTGG - Intronic
946114866 2:217452458-217452480 GTTTGGAAAGCTAATCATGGGGG + Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946696536 2:222365572-222365594 TTGAGGAACCCAAATCATGGAGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948012267 2:234658674-234658696 CTCAGGAAACATAATCACGGCGG + Intergenic
948209700 2:236183706-236183728 CTCAGGAAGCTCAATCATGGTGG - Intergenic
1170341997 20:15339523-15339545 CTCAGGATCCCCAATCATGCTGG - Intronic
1173398616 20:42704173-42704195 CTGAGGAAACCTAATCTAGAAGG - Intronic
1173943649 20:46932987-46933009 CTCAGGAAACACAATCATGTTGG - Intronic
1174093758 20:48070797-48070819 CCCAGGACACCTAATCATATTGG - Intergenic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1177285468 21:19042867-19042889 CTCAGGAAACATCATCTTGGAGG + Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1177820387 21:26024582-26024604 CTCAGCAAAACTACTTATGGCGG - Intronic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1181655528 22:24294716-24294738 CTCTGGGAACCTAGTCAAGGAGG - Intronic
1181709408 22:24672334-24672356 CTCTGGGAACCTAGTCAAGGAGG - Intergenic
1183274117 22:36880823-36880845 CTCAGGAAACCTTACAATGATGG - Intergenic
1183849761 22:40575111-40575133 CACAGGAAACTTAGGCATGGAGG - Intronic
1184851206 22:47122284-47122306 TTCGGGAAACCTCGTCATGGTGG - Intronic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
949195340 3:1299001-1299023 CTCAGCAATCCAAATAATGGTGG + Intronic
949491675 3:4595268-4595290 TTCAGGAAACTTTGTCATGGTGG + Intronic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
949694536 3:6679469-6679491 ACCAGGAAACCTAATCATGTGGG - Intergenic
950779877 3:15382240-15382262 CTCAGGAAAACTGAACTTGGTGG - Exonic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
951180489 3:19653674-19653696 CTCAGGAAACACAATCATGACGG + Intergenic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
952120141 3:30232462-30232484 CTCAGGAAACACAATCAAGGTGG + Intergenic
952221240 3:31326367-31326389 CTCAGGAAACTCAATCATGGTGG + Intergenic
956470231 3:69558900-69558922 CTCAGGAAAACTAATTAAGAAGG - Intergenic
957401874 3:79725994-79726016 CTCAAGAAGTCAAATCATGGAGG + Intronic
957780029 3:84807062-84807084 TTCAGAAAACCTAATTATTGAGG - Intergenic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957847407 3:85755622-85755644 CTCAGGAAACTCAATCATGGTGG + Intronic
959351398 3:105269146-105269168 CTCAGGAAACAAAATCCTGGTGG - Intergenic
960722435 3:120638117-120638139 CTCAGGAAATACAATCATGGTGG - Intronic
963245987 3:143063156-143063178 CTCAGGAAGCTTAGTCATGGTGG - Intergenic
965100307 3:164289597-164289619 CTCAGGAAATACGATCATGGCGG + Intergenic
965112629 3:164447526-164447548 CTTAGGATACTTACTCATGGTGG - Intergenic
965224488 3:165971309-165971331 CTCAAGAAACACAATCATTGTGG - Intergenic
965394910 3:168151775-168151797 CTCAGGAAACTTAAGCATGGTGG - Intergenic
965943256 3:174210510-174210532 CTCAGAAAATCTAGTCATCGTGG - Intronic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966342921 3:178945543-178945565 CTCAGGAAACTTAACCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967566406 3:190978786-190978808 CTCAGGAAACATAATCACGGTGG - Intergenic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
969136103 4:5030047-5030069 CTCAGGAAACTTAACCATCATGG - Intergenic
970100254 4:12513771-12513793 TTTAGGAAACATAATCATGGTGG - Intergenic
970362863 4:15327413-15327435 CTCAGGAAACCCTACCATTGTGG + Intergenic
970582597 4:17487175-17487197 CTCAGGAAGCCTAATCCAGGTGG - Exonic
971119796 4:23690470-23690492 CTCAGGAAACTTAACCATCTTGG - Intergenic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
977970114 4:103203224-103203246 TTCAGAAAACACAATCATGGTGG + Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
980089361 4:128426097-128426119 CTCAGGAAACCTCATCATTATGG - Intergenic
980185042 4:129450362-129450384 CTCAGGATACCAAATCAATGTGG + Intergenic
980519228 4:133909648-133909670 CTCAGGAAACCTCATCCTTAGGG - Intergenic
981537751 4:145817475-145817497 CTCAAGAAGCAGAATCATGGCGG + Intronic
982623751 4:157738152-157738174 CTCGGGAAACAAAAGCATGGTGG + Intergenic
983020146 4:162665971-162665993 CTCAGGAAACCTAATCACCCAGG - Intergenic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
989002003 5:36771005-36771027 GGGAGGAAACCGAATCATGGGGG - Intergenic
989179158 5:38558672-38558694 CTCAGGAAACTTAACAATCGTGG + Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989254548 5:39352054-39352076 CTCAGGAAACCCAATCATGGTGG + Intronic
989386098 5:40855937-40855959 CTCAGGAAACACAATCATGATGG - Intronic
989475402 5:41868880-41868902 CTCAGCAAACCTCATCTTAGAGG - Intronic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
990242226 5:53826961-53826983 CTCCAGAAAACTATTCATGGGGG - Intergenic
990684369 5:58284810-58284832 CTCAGCAACTCTCATCATGGAGG + Intergenic
990868951 5:60410062-60410084 CTCAGAAAAGCTAAACATCGAGG - Intronic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
991992245 5:72351583-72351605 CTCAGGAAATACAGTCATGGGGG + Intronic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
993800014 5:92320603-92320625 CTCAGGAAATGCAATCATGCTGG - Intergenic
995338022 5:111025023-111025045 CTCAGTAAGCCAAGTCATGGAGG + Intergenic
995576421 5:113540502-113540524 CTCAGGAAACTTAGTCATGATGG + Intronic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
998541003 5:142981504-142981526 TTTAGGAAACCAAATCATGAGGG - Intronic
998690868 5:144586012-144586034 CTCAGCAAACCTATTTATGAAGG + Intergenic
1000145699 5:158451287-158451309 CTCAGCAAACCTTTTCATGGTGG + Intergenic
1001257020 5:170191783-170191805 CTGAGGAAGCCTAATTATGAAGG + Intergenic
1005078228 6:21929749-21929771 CTCAGGAAATGCAGTCATGGCGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1008613237 6:53203267-53203289 CTCAAGTAACCTAATCATATAGG - Intergenic
1008771397 6:54982952-54982974 CTCAGAAAACCTCATTATGTGGG + Intergenic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1010660747 6:78568460-78568482 CTCAGGAACACTAATCATCAAGG + Intergenic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1014250016 6:119105487-119105509 CTCAGGAAACTGAATCATGGTGG - Intronic
1014313113 6:119830249-119830271 CTCAGGAAGCCACATCCTGGGGG - Intergenic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1016157084 6:140823718-140823740 CTCAGGAAAGCTACCCAGGGTGG - Intergenic
1016619525 6:146091901-146091923 CTCAAGAAACACAAACATGGTGG + Intronic
1017408968 6:154149190-154149212 CTCAGGAAACTTAACAATCGTGG + Intronic
1018511288 6:164527109-164527131 CTCAGCAAACATAATTATGGAGG - Intergenic
1022120008 7:27298906-27298928 CTCAGAAATTGTAATCATGGAGG + Intergenic
1022858250 7:34338609-34338631 CTCAGGAAACTTAACCATCATGG + Intergenic
1024291370 7:47807031-47807053 CTCAGGAAAGCTGACCAGGGTGG - Intronic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1024895874 7:54261344-54261366 CTCAGGAAACACAGTCATGGTGG + Intergenic
1025997362 7:66536483-66536505 GTCAGCAAACCTATTCTTGGGGG - Intergenic
1026576032 7:71572257-71572279 CTTCGGAAACCAAATCAGGGGGG + Intronic
1027542427 7:79484134-79484156 CACAGAAAACTTGATCATGGGGG + Intergenic
1027597941 7:80200012-80200034 GTGATGAAACCTAATCAGGGAGG + Intronic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1028432012 7:90758663-90758685 CTCGGGAAACTTAATCTTGAAGG + Intronic
1029789679 7:102829182-102829204 CTCAGGAAAGCTGCTCAAGGTGG - Intronic
1031194079 7:118590333-118590355 CTCAGGAAACTCAAACATGGTGG - Intergenic
1031323998 7:120368930-120368952 CACAGAAAACCTAATCTTGAAGG - Intronic
1032007376 7:128313863-128313885 CTCAGGAAACTTAATCATAGTGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1033790781 7:144790512-144790534 CTCAGGAAACTTAACAATCGTGG + Intronic
1034113616 7:148562814-148562836 CTTAGGAAACTTAGTCATGGCGG + Intergenic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1034778286 7:153852355-153852377 CTCAGGGAACTTAGTCATGATGG + Intergenic
1034824971 7:154253856-154253878 CTTAGGAAACACAATTATGGTGG + Intronic
1035634562 8:1134719-1134741 CTCAGGAAACTTATTCATGGTGG + Intergenic
1036057275 8:5270231-5270253 CTCAGGAAACACATTCATGGAGG - Intergenic
1036938787 8:13031552-13031574 CTGATGAAAACTAATCATGTGGG + Intergenic
1037151696 8:15643176-15643198 CTCAGTAAACATGATCATGGCGG - Intronic
1037294448 8:17385782-17385804 CACAGGAAACACAATCATGGTGG - Intronic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1040623333 8:49115119-49115141 CTCAGGAAAGCTGCTCAAGGTGG - Intergenic
1040711677 8:50195941-50195963 CTCAAGAATCATCATCATGGAGG - Intronic
1040945793 8:52883014-52883036 TTCAGGAAACATAATCATGGTGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1043953815 8:86339325-86339347 GTCAGGTAATTTAATCATGGGGG - Intergenic
1044221195 8:89672250-89672272 CTCTGGAAACAAAATCATGGTGG + Intergenic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046611378 8:116429417-116429439 CTCAGGAAACACAGTCATGGTGG + Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047827904 8:128597782-128597804 CTCACAAAACTTAGTCATGGTGG + Intergenic
1047872024 8:129094476-129094498 GACAGGAAACCCAATCATGAGGG - Intergenic
1048679618 8:136825387-136825409 CTCAGTATCCCTAATCATTGGGG + Intergenic
1048693876 8:137001910-137001932 CTCCTGAAACCAAGTCATGGAGG - Intergenic
1048968317 8:139629792-139629814 CTCAGGAATCCTAAACCTGATGG + Intronic
1049052877 8:140212641-140212663 TTCAGGAAACCTAAAAATGAAGG - Intronic
1050843660 9:10186916-10186938 CTCAAGAACATTAATCATGGGGG - Intronic
1051462027 9:17330028-17330050 CACAGGAAAACTAATCTTGTAGG - Intronic
1052796126 9:32925081-32925103 CTCTCAAAACCTGATCATGGTGG - Intergenic
1055412716 9:76048345-76048367 CTTAGGAAACCTAATAATTATGG + Intronic
1055856711 9:80697041-80697063 CTTGGGAAACACAATCATGGTGG + Intergenic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1056459067 9:86791746-86791768 CTCAGAAGACCCAGTCATGGGGG + Intergenic
1058209057 9:102144622-102144644 CACAGGAAACTTAGTCATGGTGG + Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1062153404 9:135033009-135033031 CTCAGCAAACCTCATGGTGGGGG - Intergenic
1185922951 X:4114346-4114368 CTCAGGAAAGCTGCTCAGGGTGG - Intergenic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1189236323 X:39489922-39489944 CTCAGGAAAGCTGCTCAGGGTGG + Intergenic
1189728871 X:43997769-43997791 TTCAGGAAACATAATCATGGTGG + Intergenic
1192177510 X:68895165-68895187 CTGAGGAAGCATAATCATGCTGG - Intergenic
1192695692 X:73413477-73413499 CTCAGAAAACTTAATCTTGGAGG - Intergenic
1194507758 X:94754000-94754022 CTTAGGAAACATAATCATAATGG + Intergenic
1195042727 X:101028932-101028954 CTCAGGACACACTATCATGGTGG - Intronic
1196526341 X:116731634-116731656 CTCAAGAAACCTATGCAAGGTGG + Intergenic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1198797724 X:140416700-140416722 ATCATGAAACAGAATCATGGGGG - Intergenic
1198999964 X:142624121-142624143 CTCAGGGAACTTACTCGTGGCGG + Intergenic
1200739457 Y:6837434-6837456 CTCAGGAAACACAATAATTGTGG - Intergenic
1200966819 Y:9046366-9046388 CTCAGGCAAACAAATCTTGGTGG + Intergenic
1201331768 Y:12831072-12831094 CTTAGGAAACTTAATCATGGTGG - Intronic
1201608571 Y:15815297-15815319 CTCAGGAATGATAAACATGGTGG + Intergenic