ID: 910268248

View in Genome Browser
Species Human (GRCh38)
Location 1:85364248-85364270
Sequence GTACAGAATTGGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910268248_910268253 16 Left 910268248 1:85364248-85364270 CCTTCTGCCTTCCAATTCTGTAC No data
Right 910268253 1:85364287-85364309 TATTGTAAGATCCTGTGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 108
910268248_910268251 -8 Left 910268248 1:85364248-85364270 CCTTCTGCCTTCCAATTCTGTAC No data
Right 910268251 1:85364263-85364285 TTCTGTACATTTAAGTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910268248 Original CRISPR GTACAGAATTGGAAGGCAGA AGG (reversed) Intronic
No off target data available for this crispr