ID: 910276573

View in Genome Browser
Species Human (GRCh38)
Location 1:85455637-85455659
Sequence CTGAAGAAATGGAGAGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910276573_910276579 28 Left 910276573 1:85455637-85455659 CCATTTACTCTCCATTTCTTCAG 0: 1
1: 1
2: 2
3: 51
4: 574
Right 910276579 1:85455688-85455710 ACATCAACTGACAGACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910276573 Original CRISPR CTGAAGAAATGGAGAGTAAA TGG (reversed) Intronic
901139258 1:7017826-7017848 CAGCAGAAGTGGAGAGTAAGGGG + Intronic
901557207 1:10041071-10041093 ATGAACAAAAGGAGAGGAAAGGG - Intronic
901615424 1:10535674-10535696 CTGAAGAATTGAAGAGAATAGGG + Intronic
903835117 1:26198603-26198625 CTGAATATATGGAGATTCAAGGG - Intronic
903957502 1:27035418-27035440 GTGAAAACATGGAGAGTAACTGG - Intergenic
904191715 1:28749800-28749822 CTGAATAACTGCAGAGCAAATGG + Intronic
904509361 1:30990224-30990246 CTAAAGCAATGCAGAGGAAATGG + Intronic
904787858 1:32996046-32996068 AGGAAGAAATGAAGAGTAGAAGG - Intergenic
905978361 1:42198098-42198120 CAGAAGAAATAGAGATTTAAAGG - Intronic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
906827948 1:49001923-49001945 ATGAAGAAACAGAGAGTTAAGGG - Intronic
907644432 1:56227744-56227766 CCGAATAAATGATGAGTAAATGG - Intergenic
907695194 1:56718318-56718340 ATGAAGAAATTCAAAGTAAATGG - Intergenic
907816039 1:57919126-57919148 TGGAGGAAATGGAGAGTAAGGGG - Intronic
908103217 1:60812663-60812685 CTGAAGACATTGAGCCTAAATGG + Intergenic
908766413 1:67558636-67558658 CTGAAGGAGTGGACAGTTAAAGG + Intergenic
908927740 1:69276778-69276800 CAGAACAAATGGAAAGAAAAAGG + Intergenic
908979267 1:69934677-69934699 TTAAAGAAAATGAGAGTAAAGGG - Intronic
909521297 1:76571182-76571204 CTGAAGAAATGACAATTAAAAGG - Intronic
910048278 1:82944183-82944205 CTGAAAAACTGGAGATGAAATGG + Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
913063305 1:115227184-115227206 CTGAAGAAATTCAGTGTAAGAGG + Intergenic
913345080 1:117800838-117800860 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914680801 1:149936930-149936952 CTGGAAAAGTGGAGAGGAAACGG + Intergenic
914798683 1:150943323-150943345 AGAAAGAAATGGAGACTAAATGG + Intronic
915460187 1:156065888-156065910 CTGAAGGAGTGGAGAGATAAGGG - Intronic
915541545 1:156570239-156570261 CTTAAGAAATGCAGAGATAAAGG + Intronic
915969030 1:160339475-160339497 CTGGAGAAATGGTGAGAGAAGGG - Intronic
916023175 1:160812175-160812197 GTGAAGACATGGAGAGAAAGTGG - Intronic
916128264 1:161590156-161590178 GTGAAGAAATGGAAACTCAAGGG - Intronic
916138184 1:161671987-161672009 GTGAAGAAATGGAAACTCAAGGG - Intronic
916306687 1:163343306-163343328 AAGAAGAAATGTAGAGAAAATGG + Intronic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
918723787 1:187891534-187891556 GTGAACAAAGGGAGAGTAAGAGG - Intergenic
918981413 1:191564763-191564785 CTGGAGAAATGCAGAAGAAAGGG + Intergenic
919004007 1:191871547-191871569 CTCAAAAAAGGGAGAGGAAAAGG + Intergenic
919045855 1:192450858-192450880 ATGAAGACATTGAGGGTAAAGGG + Intergenic
920261041 1:204688114-204688136 CTGAAGCAAGACAGAGTAAATGG - Intergenic
920635814 1:207702333-207702355 CTGAAGAGAGGGAGAGAGAAGGG - Intronic
920705326 1:208246368-208246390 CTGAATAAAGGGAGAGAAAGAGG + Intergenic
920724862 1:208425273-208425295 CTGCAGAAAGGGTGAGTAATAGG - Intergenic
920902998 1:210130732-210130754 CTCAGGAAATGGAAAGTTAATGG - Intronic
921460832 1:215424605-215424627 CTAAAAAAATTGAGAATAAATGG - Intergenic
921577230 1:216849996-216850018 CTAAATAAATGGAGACTGAAAGG + Intronic
921647598 1:217636218-217636240 CTGAAGACATTGAAAGTCAAAGG - Intronic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
922256968 1:223900800-223900822 CTGAAGAAAAGGACAGTGAATGG + Intergenic
922260276 1:223935745-223935767 ATGAAGAAGTGCAGAGCAAAGGG + Intergenic
922291236 1:224210538-224210560 CTGAAGGAAGTGAGAGTAAGTGG - Intergenic
922544012 1:226441709-226441731 GTGAAGCAAGAGAGAGTAAAAGG + Intergenic
922927742 1:229364493-229364515 CTGAAAAAATGGAAAGTGCAAGG + Intergenic
923002039 1:230014654-230014676 CTGAAGAAAAGTCAAGTAAAAGG + Intergenic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923409306 1:233691378-233691400 TTGAAGAAATGGAGGGTGAGAGG - Intergenic
924134471 1:240949323-240949345 CTGAAGAAATGAAGTCTAATAGG - Intronic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
924668622 1:246100270-246100292 CTGCAGAAATGATGATTAAAAGG + Intronic
924853110 1:247850645-247850667 CTGAGAAAATGGAGATAAAAGGG + Intergenic
1063376033 10:5554974-5554996 CTGCTGAAGTGGAGAGAAAAGGG + Intergenic
1064121714 10:12624797-12624819 ATGAAGAAATGGAGGCTTAAAGG - Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064790854 10:18956577-18956599 ATGTAGAAATGGATAGAAAAGGG - Intergenic
1064871018 10:19937118-19937140 CTGAAGGAATGGAGGATCAAAGG - Intronic
1065162752 10:22939848-22939870 CTGAAAAAAGGCAGAATAAAAGG + Intronic
1065647931 10:27856052-27856074 CTGTAGCAAAGGAGAGTAATGGG - Intronic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1065772442 10:29090083-29090105 TAGAAGAAAGGGAGAGGAAATGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1066435101 10:35390578-35390600 CTGAAGTAAGGGAGAGGTAAGGG - Intronic
1067392316 10:45875006-45875028 TTGAAGAGATGGTGAGGAAAAGG - Intergenic
1067402616 10:45991424-45991446 TTGAAGAGATGGTGAGGAAAAGG + Intronic
1067857641 10:49809565-49809587 CTAAAGACTTGGAAAGTAAACGG - Intergenic
1068104356 10:52594630-52594652 CTGAAGAAATGGAATAGAAAAGG + Intergenic
1068368348 10:56081768-56081790 AGGAAGAAATTGAGAGTCAAAGG + Intergenic
1069214355 10:65800843-65800865 TGGAAGAAATGGAGAGGAAGAGG - Intergenic
1069597220 10:69680053-69680075 CTGCAGCAATGGAGAGGCAATGG - Intergenic
1069932219 10:71890486-71890508 CTGAAGAAATGCATAGTAGCGGG + Intergenic
1070330276 10:75411366-75411388 GTGAAGAAAGGAAGAGGAAAGGG - Intergenic
1070701931 10:78610169-78610191 CAGAAGAAAAGGGAAGTAAAAGG + Intergenic
1071712099 10:88060071-88060093 CAGAGGAAATGGAAAGTACAAGG + Intergenic
1072408625 10:95179210-95179232 CTGAACAAAGGCAGAGAAAAGGG + Intergenic
1073645523 10:105298093-105298115 AGGAAGAAATGAAGAGAAAAAGG + Intergenic
1073898770 10:108194414-108194436 CTGAGAAAATGCAGAGAAAAGGG + Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075488109 10:122843749-122843771 CAGGAGAAATGGAGAGTGAATGG + Intronic
1075498336 10:122947970-122947992 CTGAAGAAAGTGAGACTACAAGG - Intronic
1076844554 10:133062842-133062864 CTGACGAAATGGACAGGAAACGG - Intergenic
1077872513 11:6273662-6273684 CTCAAGAAATGGAAAATAGATGG - Intergenic
1078540300 11:12207613-12207635 TTGATGAAATGAAGAGTAAAGGG - Intronic
1078607789 11:12792325-12792347 ATCAAGAAAAGGAAAGTAAAGGG + Intronic
1078739966 11:14057615-14057637 CTGAAGCATTTGAGAGTAAGTGG - Intronic
1079666199 11:23109056-23109078 CTGGAGAAGTGGAGAAAAAAAGG + Intergenic
1080075148 11:28139684-28139706 CTCAAACAAGGGAGAGTAAAGGG + Intronic
1080502528 11:32884486-32884508 CTTAAGACAGAGAGAGTAAAGGG + Intergenic
1081043936 11:38249117-38249139 TGGAGGAAATGGAGAGGAAAAGG + Intergenic
1081124118 11:39301809-39301831 CTGTAGAACTGGAGAGGCAAAGG + Intergenic
1081645013 11:44784149-44784171 CTGACAAAATGGAGAGGATACGG + Intronic
1082853739 11:57788188-57788210 CTTAAGAAATGGAGATGAAAGGG + Intronic
1083619036 11:64039919-64039941 CTGAAGCCATGGAGGATAAATGG + Intronic
1084034419 11:66499952-66499974 CTGAAGCCATGGACAGTACAGGG - Intronic
1084566723 11:69932857-69932879 CTGAAGTAATCAAGAGGAAAAGG + Intergenic
1085964996 11:81512711-81512733 GTGAAGAACTGGAGAATTAAGGG - Intergenic
1086203214 11:84228142-84228164 CGGAAGAGATGGATAGTTAAGGG - Intronic
1086821706 11:91443608-91443630 CAGGAGAAAGAGAGAGTAAAGGG + Intergenic
1086994142 11:93337493-93337515 ATGAAGAGAGGGAGAGTAAGGGG - Intronic
1087248327 11:95867313-95867335 ATGTAGAAATGTAGAGAAAAAGG - Intronic
1088381329 11:109196297-109196319 CTGAGAAAATTAAGAGTAAATGG - Intergenic
1088675852 11:112192582-112192604 CTGAAAAATTGTAAAGTAAATGG + Intronic
1088974265 11:114801660-114801682 GTGAAGAAAAGGAGAAGAAAAGG + Intergenic
1089616872 11:119699744-119699766 CTGAAGACATCGAGACTAAGTGG + Intronic
1090254791 11:125275950-125275972 ATGCAGAAAGGGAGAGTGAAGGG + Intronic
1092038552 12:5363045-5363067 ATGAATAAATGAAGAGTAAATGG + Intergenic
1092515241 12:9204679-9204701 CTCAAGAAATTGAGCATAAAGGG - Intronic
1092666716 12:10808656-10808678 TTCCAGAAATGGAGAGGAAAGGG + Intergenic
1093434652 12:19122632-19122654 CTGGAGGCATGGAGAATAAAAGG - Intergenic
1093966976 12:25338219-25338241 CTGAAGGAATGGAAAATAGATGG - Intergenic
1095601354 12:44016460-44016482 CTGAAGAAAGAAAGAGGAAAGGG - Intronic
1095696146 12:45146434-45146456 CTGTAGAAAGGGAGAGTGATAGG + Intergenic
1096716345 12:53493607-53493629 CTGAGAAAATGGAGATGAAAGGG + Intronic
1096858961 12:54509198-54509220 CTGAAAAAATGAAGACTAGAGGG + Intronic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098636088 12:72785309-72785331 CAGAATAAGTGGAGAGTAAGAGG + Intergenic
1098763725 12:74458225-74458247 CTGAACAATTTGAGATTAAATGG + Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099477490 12:83124868-83124890 CTGAAGATAGGGAGAATAACAGG + Intronic
1099512908 12:83559343-83559365 GAGAAGAAATACAGAGTAAAGGG + Intergenic
1099885796 12:88528638-88528660 CTGAAGTATTTAAGAGTAAATGG + Intronic
1100172423 12:91990706-91990728 CTGAAGCAAGGGAAAGGAAAGGG - Intronic
1100469906 12:94881339-94881361 TTGAATTAATGGATAGTAAAAGG + Intergenic
1100657608 12:96663290-96663312 GTGAAGAAATGAAGAGAAGAGGG + Intronic
1100890932 12:99125035-99125057 CTGAAAAATTGGACAGTAACTGG + Intronic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101242123 12:102848945-102848967 CTGGAGAGGTTGAGAGTAAATGG + Intronic
1102500162 12:113346619-113346641 CTGAAGGAAGGGAGGGTCAAAGG + Intronic
1102722408 12:115028741-115028763 TTCAAGTAATGGAGAGTTAATGG + Intergenic
1102792023 12:115654742-115654764 CTAAAGAGATGGAGAGAATAAGG + Intergenic
1102954731 12:117052198-117052220 CAGAAGAATTGGAAAGTTAAGGG - Intronic
1103618978 12:122174301-122174323 CTGGAGAAAAGCTGAGTAAATGG - Intronic
1104959135 12:132479920-132479942 CTGGAGAAATGGGGAGGAAAGGG + Intergenic
1105253764 13:18725725-18725747 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1105553105 13:21417000-21417022 ATGAAGAAATGGTGAGGAAGAGG - Intronic
1105947629 13:25203086-25203108 CAGAAGGAAGGGAGAGAAAATGG + Intergenic
1106201923 13:27545286-27545308 CTGGAGCAAGGGAGGGTAAATGG + Intergenic
1108347137 13:49557353-49557375 CAAAGGAAATGGAGAGGAAATGG + Intronic
1108496269 13:51028316-51028338 ATGAAGAAGTGGAGAGGACAGGG - Intergenic
1109030571 13:57183283-57183305 CTTAAGAACTGTAGAGAAAAGGG + Intergenic
1109759117 13:66803630-66803652 CTAGAGTAATGGAGAGGAAAGGG - Intronic
1109832955 13:67816276-67816298 CAGAAGAAATTGAGACTAACAGG - Intergenic
1112834700 13:103500109-103500131 CAAAAGAAATGGAGAGAAATGGG + Intergenic
1113981320 13:114279279-114279301 CTGAAGAATTGGGTAGTAACAGG - Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1115074919 14:29376714-29376736 CTGAAGAAATGCAGATAAATAGG + Intergenic
1115122053 14:29949126-29949148 CTAAACAAAAGGATAGTAAAAGG + Intronic
1115404669 14:33001216-33001238 CTGGTGAAATGGACAGAAAATGG + Intronic
1115725167 14:36206544-36206566 CTGAAGTACTTGGGAGTAAAGGG - Intergenic
1115803601 14:37024843-37024865 CTTCAGAAATGGAGAAAAAAAGG + Intronic
1116586243 14:46708393-46708415 TTGAAGAAATGGAGGAAAAATGG - Intergenic
1117853460 14:60001608-60001630 CTAAAGAAAAGGAAAGAAAAGGG + Intronic
1118018542 14:61686415-61686437 GTGAGGAAAGGGAGAGTATATGG - Intergenic
1118393645 14:65317358-65317380 ATGAAGAAATGGATAGAGAATGG + Intergenic
1118737631 14:68713408-68713430 CCGAAGAAATGGGGAAGAAAGGG + Intronic
1119113022 14:71993194-71993216 CTTAAGAGATGGAAACTAAAGGG - Intronic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1119969539 14:78954256-78954278 CTCCAGAAGTGGAGAGTCAATGG - Intronic
1120149639 14:81019017-81019039 CAGAAGAAATGAAAAGAAAAAGG + Intronic
1121004562 14:90481364-90481386 CAGAAGAATTGGAGAGGAAGAGG - Intergenic
1121266419 14:92605211-92605233 ATGTAGAAATAAAGAGTAAATGG - Intronic
1121283019 14:92713087-92713109 CTGAAATAATGCAGAGAAAACGG + Intronic
1123216134 14:106810812-106810834 CTGGAGATATGGAGTGTGAATGG - Intergenic
1123804465 15:23856981-23857003 CTGGGGAAATGGTGAGTTAAGGG + Intergenic
1125013311 15:34904580-34904602 TTCTAGAAATGGTGAGTAAATGG + Intronic
1126025532 15:44442616-44442638 CAGAAGAAAAGGACAGAAAAAGG - Intronic
1126299964 15:47184428-47184450 GAGGAGAAATGGAGAGAAAAGGG - Intronic
1126979830 15:54228392-54228414 CTTGAGAAACGGAGAGAAAAGGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127417805 15:58774047-58774069 CTGCAGAAATTCAGAGGAAAGGG + Intronic
1127431485 15:58914304-58914326 CTGATTAAATGAAGAGAAAAGGG + Intronic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1128485683 15:68085179-68085201 TTGGAGAAATAGAGAGCAAATGG + Intronic
1129280874 15:74484040-74484062 ATGAAGAAAAGAAGAGGAAAGGG + Intergenic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1131413481 15:92230947-92230969 ATGAAGAACTGAAGAGTGAAGGG + Intergenic
1131523705 15:93136195-93136217 CTAATGAAATAGAAAGTAAAAGG + Intergenic
1132126099 15:99226331-99226353 CTGAAGAATTTGGGGGTAAAGGG + Intronic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1133713584 16:8426061-8426083 CTGAATAAAGTGAAAGTAAATGG - Intergenic
1134016286 16:10890674-10890696 CGGAAGAAATGGAAGGGAAAGGG + Intronic
1134162062 16:11899521-11899543 TGGGAGAAAGGGAGAGTAAAAGG + Intronic
1134318889 16:13144598-13144620 CTAAAAAAATAGAGAGAAAAGGG + Intronic
1134770590 16:16805952-16805974 CTGATGAAATGGAGACTCAGAGG - Intergenic
1134867277 16:17619760-17619782 AAGAAGAAAAGGAGAGAAAAAGG - Intergenic
1135528432 16:23231962-23231984 CAAAAGAAATGCAGATTAAAAGG - Intergenic
1135699404 16:24618620-24618642 TTCATGAAATGGAAAGTAAAAGG - Intergenic
1135748469 16:25037290-25037312 CTGTAGAAAGGGAGAGTGAGTGG - Intergenic
1136344571 16:29666464-29666486 CTGCAGAAATGGAGACTTCAAGG - Exonic
1139160990 16:64508179-64508201 CTAAAGGAAAGGAGAGGAAAAGG - Intergenic
1139171764 16:64638912-64638934 CTTAAGAAAAGGAGAGCTAAGGG + Intergenic
1139284587 16:65799276-65799298 GTGAAAAAATGGAAATTAAAAGG + Intergenic
1140542614 16:75771735-75771757 ATCAGGAAATGGAGAGTGAATGG + Intergenic
1140995294 16:80253082-80253104 CTGAGGAAAGTGAGAGTCAAAGG - Intergenic
1141140279 16:81492822-81492844 GGGGAGAAATGGGGAGTAAAGGG + Intronic
1141936159 16:87239564-87239586 CACATGAAATGAAGAGTAAAAGG - Intronic
1142336516 16:89492764-89492786 GAAAAGAAATGCAGAGTAAAGGG + Intronic
1142441380 16:90100530-90100552 CTAAAGAAATGGAGGCCAAATGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142761300 17:2043273-2043295 CTGAAGAAAAGGGGAGCACAAGG + Exonic
1142829593 17:2538323-2538345 CTGGAGAAAAGCAGGGTAAAAGG - Intergenic
1142834947 17:2578202-2578224 ATGAAGAGATGGAGAGTAGCTGG - Intergenic
1142928473 17:3261419-3261441 CTGACCAAATGCTGAGTAAAAGG + Intergenic
1144592566 17:16536795-16536817 CTGAAGTTAGGGAGAGGAAAGGG + Intergenic
1144805472 17:17963510-17963532 GTGAAGAAATAGAGACTTAAAGG - Intronic
1144996211 17:19270949-19270971 CTCAAGAAATGGAGACCGAAAGG + Intronic
1146542738 17:33711673-33711695 CTGAAGAGAGAGAGAGTGAAGGG + Intronic
1146940767 17:36843051-36843073 AAGAAAAAATGGAGAGAAAATGG - Intergenic
1147265167 17:39230325-39230347 CAGAATAAATGCACAGTAAATGG + Intergenic
1149081750 17:52666180-52666202 CTGAAGAAAGGTAGATTAATAGG + Intergenic
1149259744 17:54865758-54865780 CTGGAGAAATGATGAGTAACAGG + Intergenic
1149264039 17:54908272-54908294 ATGAAGATATGAAGAGTCAAAGG - Intronic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150457931 17:65322746-65322768 CTGAAGAAACTAAGTGTAAAGGG + Intergenic
1150619237 17:66796939-66796961 CAGAACAAATAAAGAGTAAAGGG - Intronic
1150972310 17:70042724-70042746 CTGAAGATATGGAGAAAAAGGGG - Intergenic
1151073092 17:71239846-71239868 AGAAAGAAATGGAGAGTAATGGG + Intergenic
1152479984 17:80544680-80544702 CTGAACAAATGGCGATTAACTGG + Intergenic
1153082149 18:1239793-1239815 TAGAAGAAATGGTGAGAAAAAGG - Intergenic
1153543929 18:6186475-6186497 CCGAAGAAATGGGGAGGACATGG + Intronic
1155244083 18:23890804-23890826 CCAAAGGAATGCAGAGTAAATGG + Intronic
1155679087 18:28467469-28467491 CTGAAGAAATACAGAGTGATAGG - Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155862747 18:30924126-30924148 ATGAACGAATGGACAGTAAATGG - Intergenic
1156110632 18:33722109-33722131 CTGAAGAAAGGGAGAGAAATGGG - Intronic
1156566625 18:38198608-38198630 GTGAAGACATAGAGAGAAAATGG - Intergenic
1156646530 18:39168962-39168984 GAGAAGAAAAGGAGAGAAAAGGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157052402 18:44181969-44181991 TTTAAGCAATGGAGAGTAATCGG - Intergenic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157477022 18:48029968-48029990 CTGGAGAAAGGGGGAGCAAAAGG - Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157748983 18:50161480-50161502 CTGAAGGAATTTAGAGGAAATGG + Intronic
1157757669 18:50232856-50232878 AGGAAGGAATGGAGAGGAAAAGG - Intronic
1159023151 18:63159513-63159535 TTGTAAAAATGGAAAGTAAAAGG - Intronic
1159708455 18:71722756-71722778 CTGAAAAAGTGGTGAGGAAATGG - Intergenic
1159856339 18:73594066-73594088 TTGAAGAAATGTAGAATAGAGGG + Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1160225895 18:77010167-77010189 CTCAGGAAATCGAGAGCAAAAGG + Intronic
1160655354 19:264168-264190 CTGAAGAAATGGCCAATACAGGG + Intergenic
1160957668 19:1700877-1700899 CAGAAGAAATGGAAACTAAGAGG - Intergenic
1162872667 19:13598254-13598276 TTGAGGAAAAGGAAAGTAAAGGG + Intronic
1164729538 19:30492229-30492251 ATGCAGAAATGGAGAGAAAGGGG - Intronic
1165235371 19:34416575-34416597 CTACAGAAATGTAGAGGAAATGG + Intronic
1165581202 19:36865295-36865317 GTGAAAAAATGGTGAATAAAGGG + Intronic
1166142966 19:40815232-40815254 GAGAAGAGATGGAGAGGAAAAGG - Intronic
1167161107 19:47767686-47767708 CAGAAGAAAAGGAAAGAAAAAGG + Intergenic
1168024396 19:53633279-53633301 CTCAAGAAAAAGAAAGTAAAAGG + Intronic
1168470192 19:56633587-56633609 GGGATGAAATGGAGAGTGAAGGG + Intergenic
925575096 2:5352053-5352075 ATTAAGAAATGGAGAATCAAAGG + Intergenic
925925626 2:8668117-8668139 ATGAAGGGATGAAGAGTAAATGG + Intergenic
926081802 2:9993223-9993245 CTGAAGAATTGGAGGGTGAAGGG + Exonic
926693212 2:15751655-15751677 CAGAGGGAATGTAGAGTAAAGGG + Intergenic
927620889 2:24657102-24657124 GGGAAGAAATGAAGAGAAAAGGG - Intronic
927757469 2:25720493-25720515 CTGAGCAAATGCAGAGGAAATGG + Intergenic
927926598 2:27018078-27018100 CTGAAGAAAAGGAAAGGCAATGG - Intronic
928923475 2:36551628-36551650 CTGAAGAAATGTAGCTTTAAAGG - Intronic
929737071 2:44561579-44561601 CTGAATTGATTGAGAGTAAATGG - Intronic
929882672 2:45850839-45850861 CTGAAGAAATGGAGGATGAGGGG - Intronic
930087181 2:47505936-47505958 ATGGAGAAATGGGGAGTAAAGGG + Intronic
930372370 2:50518770-50518792 AAGAAGAAATGGAAAGTAAAAGG - Intronic
930581500 2:53217288-53217310 CTGAAGCCAGGGAGACTAAATGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930806445 2:55495358-55495380 TAGAAGAGTTGGAGAGTAAATGG + Intergenic
931378092 2:61726195-61726217 CTGAAGACATTGAGAATCAATGG + Intergenic
931609401 2:64082249-64082271 GTGGGTAAATGGAGAGTAAAAGG - Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
932237509 2:70132519-70132541 AGGAAGAAAAGGAGAGTAAAGGG - Intergenic
932525559 2:72463388-72463410 GTGAAGCAATGAAGACTAAAGGG + Intronic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
934488006 2:94735928-94735950 CTGAATCCATGGAGAGAAAAAGG - Intergenic
934875149 2:97911283-97911305 CTAAAGATAAGGAGCGTAAAGGG + Intronic
935661036 2:105467315-105467337 CTGAAAAAAGGGGCAGTAAATGG - Intergenic
935803314 2:106721696-106721718 CTGAACAAATGCTGATTAAAAGG - Intergenic
936099083 2:109559529-109559551 CTGAAGAAATGCTCAGCAAATGG + Intronic
936764296 2:115827024-115827046 CAGAAGAAATGGAAAGTGTATGG - Intronic
937111696 2:119371562-119371584 CTGAAGCACTGGAGAGTACATGG - Intronic
937409619 2:121662073-121662095 CTGAAGAATGGTAGAGTAAGGGG + Intergenic
937460912 2:122084872-122084894 TTGAGGAAACGGAGAGAAAATGG + Intergenic
937844170 2:126559569-126559591 CTGAAACAATGGAGACTAAAAGG + Intergenic
938610123 2:132938719-132938741 CTGGAGAAAGGTAGAGGAAAGGG + Intronic
938645713 2:133328015-133328037 CTGAAGATGTGGAGAGTATTTGG - Intronic
939764294 2:146226986-146227008 CTGATAAAATGGAAAGTAAAAGG + Intergenic
940111461 2:150159507-150159529 CACAAGAAATGGAGACTTAACGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940959934 2:159773976-159773998 CTGAAGAAATGTTGAGAAAATGG - Intronic
941499989 2:166262297-166262319 CTGAATAAATGGAAAGGAAAGGG + Intronic
941693182 2:168522858-168522880 TTGAATAAAGGGAGAGAAAATGG + Intronic
942338118 2:174913235-174913257 CTGGAGAAATGCAGGGGAAATGG + Intronic
942490605 2:176485935-176485957 AGGAAGATAGGGAGAGTAAAAGG + Intergenic
942867120 2:180690356-180690378 CTGAACAAACGGATAGAAAATGG + Intergenic
942983549 2:182111340-182111362 CTTAAGTAATGGGGAGTTAAAGG + Intronic
943210652 2:184961538-184961560 CTGAAGAAAAGAAGAATTAAAGG - Intergenic
943972964 2:194434391-194434413 TTGAAGAAATGGGAAGTAAGTGG + Intergenic
945531286 2:210956386-210956408 CTGAACAAATGGAGAGCCCAAGG - Intergenic
945694408 2:213084623-213084645 CTTAAGAAAGGGAGAGTTGAAGG - Intronic
945932991 2:215874666-215874688 CTCGAGAAATGGAGAGTATGAGG - Intergenic
946028523 2:216687327-216687349 CTGAAGATATATAGAGAAAAGGG + Intronic
946406154 2:219493049-219493071 ATGGAGAAGTGGAGAGGAAAAGG + Exonic
946972263 2:225107709-225107731 CTGAAGAATGAGAGAGAAAAGGG - Intergenic
947093634 2:226541892-226541914 TTGAAGAAAAGCAGAGTAATAGG + Intergenic
948314963 2:237021057-237021079 TGGAAGAAATGGTGAGCAAAGGG - Intergenic
948535681 2:238644727-238644749 GTGAAGCAACGCAGAGTAAAAGG - Intergenic
948677648 2:239608185-239608207 ATGGAGAAAGGGAGTGTAAAGGG - Intergenic
1169811178 20:9610889-9610911 CAGAAGAGATGGAGGGGAAATGG - Intronic
1170172627 20:13432388-13432410 CTCTGGAAATGGAGTGTAAAAGG + Intronic
1170297114 20:14839888-14839910 TTGAGAAAATGGAGAGCAAAAGG - Intronic
1170419131 20:16175127-16175149 CTAAAGAAATGCACAGTACAAGG + Intergenic
1170898994 20:20441976-20441998 CTGAATAAATTTAGAGAAAAAGG + Intronic
1172747124 20:37220095-37220117 GGGAGGAAAAGGAGAGTAAATGG - Intronic
1173078665 20:39845317-39845339 CTAAAGCAATAGAGAGTAATGGG + Intergenic
1173181157 20:40807307-40807329 CTGAGTAACTGGAGAGTGAATGG + Intergenic
1173271972 20:41545195-41545217 CTGAGGAAATGAAGACTTAAGGG - Intronic
1173652540 20:44675989-44676011 CTGAATAAAAGGAGAGAAATAGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174921465 20:54706896-54706918 ATGAAGAATTGGAGAGTGAAGGG + Intergenic
1175563365 20:59952415-59952437 ATGAAGGAAAGGAAAGTAAAGGG - Intergenic
1176095628 20:63343001-63343023 CTGCAGACAGGGAGTGTAAACGG + Intergenic
1176839273 21:13825721-13825743 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1177242099 21:18471987-18472009 CTGATTAAATGGAAAGTAAAAGG + Intronic
1177588466 21:23130074-23130096 CTAAAGAAACTGAGAATAAATGG - Intergenic
1177760448 21:25396891-25396913 CAGAAGAGATAGAGATTAAATGG + Intergenic
1178195903 21:30344786-30344808 CTGAAGAAAGGGAGAGAGACAGG - Intergenic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1182035725 22:27196831-27196853 CTGGAGACATGCAGAGGAAAGGG - Intergenic
1182156721 22:28080697-28080719 CAAAAGAAAAGGAGAGAAAAGGG - Intronic
1183270346 22:36858421-36858443 CAGAAGAAAAGGAGAGAAAGAGG + Intergenic
1184488681 22:44796560-44796582 CTGAAGAAATGAAGCTTCAATGG + Intronic
1184877501 22:47284719-47284741 CTGAGGAAATGGTCAGCAAATGG + Intergenic
949448791 3:4163883-4163905 CTGTAGAAATGGAAAATATATGG - Intronic
949635497 3:5977421-5977443 CTGAAGAAAAGAAGAGCTAATGG + Intergenic
951158888 3:19391028-19391050 CTAAAGAAATAGAGAGTTAAGGG - Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
953126262 3:40094316-40094338 GTGAATAAATGGAGACTAAGAGG + Intronic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953383235 3:42489957-42489979 CTGAAGAAATGGAGGGTCGGAGG - Intronic
956176661 3:66479218-66479240 CAGAGGAAATGCAGAGAAAACGG + Intronic
956851720 3:73234122-73234144 ATGAGGAAATGGTGAGTAATAGG - Intergenic
957542508 3:81591744-81591766 CTGAAAGAATAGAAAGTAAATGG - Intronic
957566462 3:81890568-81890590 TTGAATAAATGAAGAATAAATGG - Intergenic
957725624 3:84063003-84063025 ATGAAGAAATAAAGAGCAAAAGG - Intergenic
957933851 3:86916793-86916815 CAGAAGAGAGAGAGAGTAAAGGG - Intergenic
957956300 3:87192587-87192609 ATGAAGAGATAGAGAGTAATAGG - Intergenic
958262413 3:91397206-91397228 CTTCAAAAATGGAGAGAAAAGGG - Intergenic
958453243 3:94299629-94299651 CTCAATAAATGGAAAGGAAAAGG + Intergenic
958472405 3:94537393-94537415 CTGAAGACATGGAAATCAAATGG - Intergenic
958532132 3:95347873-95347895 CTGAAGAAATGTAGAATGGAAGG - Intergenic
958640319 3:96797086-96797108 ATGAAGAAATGGAGGCAAAAAGG + Intergenic
958686591 3:97406172-97406194 CTGAAGAAATAGAGGGCAAGAGG + Intronic
958900671 3:99882457-99882479 ATGAACAAATTAAGAGTAAAAGG + Intronic
958987469 3:100799010-100799032 CAGAAATAATGGAAAGTAAAAGG - Intronic
959154096 3:102645309-102645331 ATGAAAAAATTGAGAGAAAAAGG - Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
960036605 3:113108681-113108703 CTGAAGAAAGGAAAAGAAAAAGG + Intergenic
960259596 3:115551586-115551608 GTGAGGAAATGGCAAGTAAAAGG - Intergenic
960273145 3:115696517-115696539 ACCAAGAAATGGAGAGTAACAGG - Intronic
960675510 3:120190822-120190844 CTGAAGTAAATGAAAGTAAAAGG + Intronic
961160457 3:124719678-124719700 CTGAAGAAATAAAGAGGCAAAGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961907006 3:130273353-130273375 CTGATGAAATGGAGATTACCAGG + Intergenic
962262584 3:133923227-133923249 CTGAAGAAATCTAAAATAAATGG + Intergenic
962372214 3:134830222-134830244 CTGAAGTAATTAGGAGTAAATGG - Intronic
964271601 3:154962185-154962207 AGGAAGAAAAGGAAAGTAAATGG + Intergenic
965491207 3:169338649-169338671 TGCAAGAAAAGGAGAGTAAAGGG + Intronic
966282641 3:178250686-178250708 CAGAAGAAAAGGAGAGTAAGGGG + Intergenic
966627699 3:182036487-182036509 GTGAAGAAAAGGAAAGGAAAGGG - Intergenic
966959697 3:184922871-184922893 GAGAAGAAATGGAAAGGAAATGG + Intronic
967143374 3:186583512-186583534 CTGTAGAAATGCAGATAAAATGG - Intronic
967983548 3:195079409-195079431 CTGAAGAAATACAGGGAAAACGG + Intronic
968361641 3:198151506-198151528 CTAAAGAAATGGAGGCCAAATGG - Intergenic
969069615 4:4524877-4524899 TTGAAGAAATGTACAGAAAAAGG + Intronic
971133815 4:23843607-23843629 ATGAACAAATGGAGTGAAAAAGG + Intronic
971185197 4:24368829-24368851 CGGAAGAAACGGAGAGTGAACGG + Intergenic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971576623 4:28282733-28282755 CTCAAGAAACTTAGAGTAAAGGG + Intergenic
972300423 4:37780462-37780484 CAGGAGAAATACAGAGTAAAGGG + Intergenic
973238187 4:47928714-47928736 ATGAGGAAATGGAAAGTATAAGG + Intronic
973698393 4:53513338-53513360 ATGAAGATATGGACAGTAGAAGG + Intronic
974106568 4:57476339-57476361 TTGAAGAGATGGAGAGTTAAAGG - Intergenic
974545154 4:63295505-63295527 TTGATTAAATGGTGAGTAAATGG - Intergenic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
974702409 4:65468871-65468893 GTGACAAAATGGAGAGTAAATGG - Intronic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975174996 4:71278127-71278149 CCATAGAAACGGAGAGTAAAAGG - Intronic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
976855948 4:89605702-89605724 CTGAAAAAAAGGATAGTAGATGG + Intergenic
977734437 4:100396367-100396389 CTCATGAAATGTAGAGAAAATGG + Exonic
977855379 4:101884580-101884602 CTGAAAAAATGGGGTTTAAAGGG - Intronic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
978676552 4:111325772-111325794 CTGAAGCAATCCAGAGAAAAAGG - Intergenic
978827988 4:113047736-113047758 CTGAAGCAATGGTGAGAGAATGG + Intronic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
979770351 4:124516761-124516783 CAGAAGAAATTGAGACTATATGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980078006 4:128314378-128314400 CTGAATAATTTGAGAGTAAGTGG + Intergenic
980320768 4:131271502-131271524 CTGAAGACAAGCAGAGAAAATGG - Intergenic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
981981608 4:150799613-150799635 CTGAAGAGATGTATAATAAAAGG - Intronic
982670481 4:158314267-158314289 CTGGGGAAAGGGTGAGTAAAGGG - Intergenic
982912379 4:161160704-161160726 CTGAGAAATTGGAGAGAAAAAGG - Intergenic
983433377 4:167679883-167679905 ATGAAGAAATTGAGAGGAAAGGG - Intergenic
983682858 4:170373449-170373471 CGGAAGAAATGGAGGTTTAATGG - Intergenic
983777609 4:171627745-171627767 CTGAGTAAATGAAGAGTTAATGG - Intergenic
986149817 5:5117413-5117435 ATTAAGAAATTGAGAGGAAATGG - Intergenic
987218159 5:15761180-15761202 CTGAAGCAGTGGAAAGGAAATGG - Intronic
987978072 5:25042147-25042169 CTGAGGAAATGGAGAGCAACAGG - Intergenic
987988945 5:25185403-25185425 CCTAAGAAATGGAGACTAGATGG - Intergenic
988342430 5:29990537-29990559 CAGAAGGAATGGAGAATAGAAGG + Intergenic
988417337 5:30961836-30961858 CTGAAGATATGGATAATACATGG + Intergenic
988737485 5:34037295-34037317 ATGAAGCAAAGGAGAGAAAAAGG + Intronic
988872423 5:35405875-35405897 CTGAAGAAATGCAGAATCAAGGG - Intergenic
990095465 5:52106928-52106950 ATAAAAAATTGGAGAGTAAAAGG + Intergenic
990686622 5:58310027-58310049 CAGAAGAAGTGAAGAGAAAAAGG - Intergenic
990858980 5:60304343-60304365 TTGATGAAATGGAGAGAGAAGGG + Intronic
991204376 5:64033549-64033571 ATGAAGAAATGAAAAGAAAATGG - Intergenic
991619475 5:68530699-68530721 CAGAAAAAATGGAGAGTTAGAGG + Intergenic
992040584 5:72827004-72827026 GAGAGGAAATGGAGAGTAAAGGG + Intronic
992140900 5:73796053-73796075 TTGAAGAAATAGAGAGTACCTGG - Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993199194 5:84790757-84790779 CAGAAGAAATGGAGGATAATGGG - Intergenic
993643707 5:90436763-90436785 TTCAAGAAAGGGAGAGTAACAGG - Intergenic
993823781 5:92655411-92655433 CAGAAGACATGGAGAATAAAGGG - Intergenic
994431295 5:99664856-99664878 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
994763157 5:103882278-103882300 CTCAAGAAATGCAGAGAAATTGG - Intergenic
994857341 5:105140441-105140463 CTGTAAAAGTGGAGAGTAATTGG + Intergenic
995077155 5:107999308-107999330 CCTAAGATATGGAGGGTAAAAGG - Intronic
995358845 5:111270309-111270331 ATTAAGAAATGGACAGGAAAAGG - Intronic
995741770 5:115363522-115363544 CTGAGGCAAGGGAGAGGAAAGGG - Intergenic
995882318 5:116856977-116856999 ATGAAGAGATGGAAAGAAAAAGG - Intergenic
997725710 5:136118330-136118352 AGGAAGAAGTGGAGAGGAAAGGG - Intergenic
998356645 5:141543020-141543042 CTGAAGAATTTAAGGGTAAAAGG + Intronic
999327247 5:150650883-150650905 CTGAAGCAGCGGAGAGGAAACGG - Exonic
999779899 5:154840875-154840897 CTGAAGAAAGGAAGAGAGAATGG + Intronic
1000818074 5:165948591-165948613 GTGTAGAAATGTAGAGTGAAAGG - Intergenic
1002336080 5:178479233-178479255 CTGAAGAAATGGAGGTTCATAGG + Intronic
1002665702 5:180822745-180822767 CTGAATATATAGAGAATAAATGG - Intergenic
1003696531 6:8411297-8411319 CAAAAGAAATGGAGTTTAAAGGG + Intergenic
1004286724 6:14328208-14328230 CTGAAGAATTTAGGAGTAAAAGG + Intergenic
1004517270 6:16330951-16330973 CTGAAGAAATGAAGTGTTGAAGG + Intronic
1004668279 6:17769963-17769985 ATGAAGAAATAGAGGGAAAATGG + Intronic
1004757609 6:18629889-18629911 CTGAAGAAATGAAAAGTGCAGGG + Intergenic
1004861927 6:19813139-19813161 CTGAAGTAGTGCAGAGTAAAGGG - Intergenic
1004883485 6:20031207-20031229 CTGAAAAACTGGAGAATCAATGG - Intergenic
1005161648 6:22871174-22871196 CTGAAGAAAGGCAGATTAACAGG + Intergenic
1005518253 6:26574906-26574928 CAAAAGAAATGGAGGGCAAAAGG - Intergenic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1008700403 6:54092795-54092817 CTGAAGTGATGGAAAGTCAATGG - Intronic
1008993005 6:57625671-57625693 CTTCAAAAATGGAGAGAAAAGGG + Intronic
1009181619 6:60524776-60524798 CTTCAAAAATGGAGAGAAAAGGG + Intergenic
1009553271 6:65127735-65127757 ATGAAGAAATGGATACTGAAGGG - Intronic
1010796759 6:80125661-80125683 CTGAAGAAAGGGAGAGATAAAGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1013984575 6:116174941-116174963 CTTAAGAAAAGGAGACAAAATGG - Intronic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014570253 6:122998195-122998217 CTGGAAAATGGGAGAGTAAAAGG - Intronic
1014696210 6:124624221-124624243 CTGAAGAAAGGAAGAGAAATGGG + Intronic
1015082517 6:129245025-129245047 CTGAAGAACAGGAAAGTGAATGG + Intronic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1016666541 6:146648536-146648558 CAGGAGAGAGGGAGAGTAAAGGG + Intronic
1016963100 6:149692340-149692362 CTGAAGAAGTACAGAGTTAATGG - Intronic
1017263411 6:152414441-152414463 CTGTAAGAATGAAGAGTAAATGG - Intronic
1019254042 7:37216-37238 CTAAAGAAATGGAGGCCAAATGG + Intergenic
1020100880 7:5393824-5393846 CTGCAGAAATGCAGAAGAAAAGG + Intronic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020785077 7:12563466-12563488 CTCAAGATATCAAGAGTAAAAGG + Intergenic
1020875820 7:13692211-13692233 CTGTAGAAATAGAGATGAAAAGG + Intergenic
1020989604 7:15180513-15180535 TGGTAGAAATGGATAGTAAAAGG - Intergenic
1021344272 7:19504788-19504810 TTGAAAAAAAGGAGATTAAATGG - Intergenic
1022260144 7:28695939-28695961 CTGAAAAAAAAGAGAGCAAAGGG + Intronic
1022651942 7:32285638-32285660 CTGAAGAAAGGGAAAAGAAAGGG + Intronic
1024369428 7:48563346-48563368 CTGAAGAAAGAGAGGGTTAAAGG + Intronic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1024742778 7:52372844-52372866 CTGAAGCAATGGGAAGTAAGGGG - Intergenic
1026055460 7:66979868-66979890 CAGAAGAGATGGAGAGTGGATGG - Intergenic
1026061078 7:67026870-67026892 CTGAAGACCTGGAGTTTAAAAGG + Intronic
1026717286 7:72800523-72800545 CTGAAGACCTGGAGTTTAAAAGG - Intronic
1026722239 7:72841958-72841980 CAGAAGAGATGGAGAGTGGATGG + Intergenic
1026736977 7:72954934-72954956 CTGAAGAACTGGAGAAGAAGTGG - Intergenic
1026852037 7:73730587-73730609 TTGAAGAAATGGAGAATTCAGGG + Intergenic
1027106755 7:75410129-75410151 CTGAAGAACTGGAGAAGAAGTGG + Intronic
1027221444 7:76216766-76216788 CTGCAGAATTGGACAGTAAAAGG - Intronic
1027733680 7:81906486-81906508 GGGAAGACATTGAGAGTAAATGG + Intergenic
1027865205 7:83637633-83637655 CAGAAGAAGTGCAGAGCAAAAGG - Intronic
1029159123 7:98539203-98539225 CTGGAGTATTGGAGAGTAAGTGG - Intergenic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1029858159 7:103540010-103540032 CTGAAGGAATAGAGAATGAAAGG + Intronic
1030535264 7:110758322-110758344 GTGAAGAAAAGGAGAGAAATAGG + Intronic
1030865282 7:114695167-114695189 CTGAACATACGGAGGGTAAAGGG - Intergenic
1031067016 7:117115934-117115956 ATGAAGAGATGGAGAGAGAAAGG - Intronic
1031197568 7:118635919-118635941 ATGAAGGAAAAGAGAGTAAAGGG - Intergenic
1031695943 7:124854326-124854348 CTGAATAATTGGAAAGCAAAGGG + Intronic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1032519610 7:132534025-132534047 CTGAAGAAAGGGAAATAAAATGG + Intronic
1032973457 7:137192841-137192863 CGGAAACAATGGAGAGCAAAAGG + Intergenic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033710011 7:143933478-143933500 CTAAAGAAATGGAGATTTATGGG - Intergenic
1034351491 7:150417757-150417779 CTCAAGAAAATGAGAGAAAAGGG - Intergenic
1034673414 7:152873768-152873790 CTGAAGAAATAGGTAGGAAAGGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036703810 8:11031627-11031649 GGGAAGGAATGGAGAGCAAATGG + Intronic
1037694996 8:21215840-21215862 CTCACCAAAGGGAGAGTAAAAGG - Intergenic
1038226948 8:25666356-25666378 CTGAAGAAATGGGAATTAATTGG - Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038776068 8:30531796-30531818 GCAAAGAGATGGAGAGTAAAAGG + Intronic
1038788417 8:30643726-30643748 CTGAAGAAATCTTTAGTAAAAGG - Intronic
1038960193 8:32509897-32509919 CTGAATGAAAGGAGAGTAAAAGG - Intronic
1039003586 8:33008866-33008888 CAGAAGAAATGGAAACAAAAAGG + Intergenic
1039304880 8:36250676-36250698 ATGGAGAAATGAAGATTAAATGG - Intergenic
1039376317 8:37037765-37037787 ATGAAGAAATGGAGGCTGAAAGG + Intergenic
1040467002 8:47704743-47704765 ATGAAGAAATGGAGAATGATTGG + Intronic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1041361910 8:57063912-57063934 TTGATGAAAGGGAGAATAAAAGG + Intergenic
1041904482 8:63016987-63017009 TCTAAGAAATGGAGAGTAATGGG + Intronic
1042501785 8:69516347-69516369 CAGGAGGAAGGGAGAGTAAAGGG + Intronic
1042792069 8:72619139-72619161 CTGAAGAAATCAAGATTGAATGG - Intronic
1043127496 8:76418064-76418086 CTGGAGAAAGAGAGAGTGAAGGG - Intergenic
1043136173 8:76528531-76528553 CTGAAGAAAAGGACAATAAAAGG - Intergenic
1044068016 8:87722482-87722504 GTGAAGAAAAGGAGAGAAACAGG + Intergenic
1044186178 8:89254339-89254361 CTGAGGAAATGGTGAGTTAAAGG - Intergenic
1044377285 8:91491104-91491126 CTGAAGAAAAGAAGACTCAATGG - Intergenic
1045092959 8:98766058-98766080 GTGAAGAAATGGAGTGATAAGGG - Intronic
1045558453 8:103237654-103237676 ATGAGGAAATGGAGACTTAAAGG + Intergenic
1045645620 8:104294325-104294347 CTTTTGAAATGGAAAGTAAATGG + Intergenic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046358990 8:113125810-113125832 CTGATGAGAAGGAGAGGAAAAGG + Intronic
1046526173 8:115384710-115384732 ATGAAGAAAGGGAGAGAAAGAGG - Intergenic
1047056370 8:121169079-121169101 TGGAAGAAATAGAGAGTACAAGG - Intergenic
1047606211 8:126477448-126477470 CTAAGGAAAAAGAGAGTAAAGGG + Intergenic
1047980885 8:130180778-130180800 CGGAAGAAATGGAGAAGGAAAGG - Exonic
1048053689 8:130843983-130844005 CTGAATAAATGGAGAAGAAAGGG + Intronic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049912992 9:287731-287753 CTGAATAAATGGACTGAAAATGG - Intronic
1050009006 9:1165968-1165990 TGGAAGAAATGGAGACTAAGAGG + Intergenic
1050152933 9:2635111-2635133 ATGAAGAGATGGAAAGAAAATGG + Intronic
1050172485 9:2836298-2836320 CTGGAGAAAAAGAGAATAAAAGG + Intronic
1050453113 9:5804892-5804914 CAGAAGAAATGGTGAATGAATGG - Intronic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1050649735 9:7763107-7763129 CTGAAGAAACGGAGAGACACAGG - Intergenic
1050650983 9:7776370-7776392 CACAAGACATGGAGGGTAAAAGG - Intergenic
1051147587 9:14044038-14044060 CTGAGAAAATGAAGACTAAAAGG + Intergenic
1051397263 9:16637289-16637311 CTGAATACATGAACAGTAAAGGG - Intronic
1051470298 9:17432555-17432577 CTGAAGGATGGGAGATTAAATGG + Intronic
1051494957 9:17710203-17710225 AAGAAGAAATGCAGAGCAAAAGG - Intronic
1051580956 9:18673585-18673607 CTGAAGTGAAGGAGAATAAAAGG - Intronic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1052618075 9:30868747-30868769 GTAAACAAATGGAGAGTAATGGG - Intergenic
1053034614 9:34813920-34813942 CTGAATGAAATGAGAGTAAATGG - Intergenic
1053669791 9:40348491-40348513 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1053919588 9:42974746-42974768 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1054514821 9:66027805-66027827 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1054857166 9:69913602-69913624 CTTAACAAATTGAGAGTTAAGGG - Intergenic
1055673700 9:78633200-78633222 GTGAATGAATGGAGAGTTAAAGG + Intergenic
1055764125 9:79643269-79643291 CTGAACTAATTGAAAGTAAAAGG + Intronic
1055806909 9:80105939-80105961 CTCAAGAAAAGGACAGTAGAAGG + Intergenic
1056871509 9:90285808-90285830 CTGAGGAAATGGAGATTGACCGG + Intergenic
1057108749 9:92446887-92446909 ATGAAGAAAAGGAGGGAAAAAGG + Intronic
1057908543 9:99000941-99000963 CTGAAGAAAAGGTGAGTAGATGG + Exonic
1057987146 9:99728862-99728884 CTGATAAAATGAAGAGTTAAGGG - Intergenic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058356410 9:104088742-104088764 CAGGAGAAATGAAGAGTGAAAGG - Intergenic
1058597618 9:106631725-106631747 ATGATGGAATGGAGAGTCAATGG + Intergenic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1059850924 9:118338448-118338470 CAGAAGACAAGGAGAGAAAATGG - Intergenic
1061405103 9:130389386-130389408 AAGAAGAAATGGGGAGAAAACGG - Intronic
1061501829 9:131008546-131008568 GTTAATAAATGGGGAGTAAAGGG + Intergenic
1061807066 9:133142551-133142573 GTGAGGAAGTGGAGAGGAAAGGG - Intronic
1185972566 X:4681761-4681783 TTGAAGAAAGGAAGAGTATAAGG + Intergenic
1186522632 X:10219930-10219952 CTGAAGAAAAGTAGGGTAACAGG - Intronic
1186815348 X:13231767-13231789 TTTTTGAAATGGAGAGTAAATGG + Intergenic
1187237544 X:17482375-17482397 CTGAAGCATTGCAGAGGAAATGG - Intronic
1187587879 X:20684093-20684115 CTGAAAAAATGAAAAGTAGATGG + Intergenic
1188233494 X:27696635-27696657 GTGAAGAAGTTGTGAGTAAATGG + Intronic
1188348505 X:29098278-29098300 CAGAAGAAAGGAAGTGTAAAAGG - Intronic
1188913457 X:35879802-35879824 CTAAAGATATTGAGAGTATAAGG + Intergenic
1189101748 X:38197725-38197747 CTGAAGAAAATGGGACTAAAAGG + Intronic
1189887391 X:45562219-45562241 CTGAAGTAAGAGAGAGTAAAGGG + Intergenic
1190513805 X:51202269-51202291 CTAAAGAAATTGAGTGTATAAGG + Intergenic
1190932686 X:54962696-54962718 ATGAAGAAAAGGAGACTATAGGG + Intronic
1191718625 X:64210480-64210502 TTAAAGAATTGGAGAGTGAAGGG - Intergenic
1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG + Intergenic
1193142114 X:78038360-78038382 TAGAAGAAATGGAGAATGAATGG + Intronic
1194462848 X:94194663-94194685 CTAATTAAATGGAGATTAAATGG + Intergenic
1194470896 X:94295607-94295629 CTCAAGAAATGGAGAGAAGGAGG + Intergenic
1194785231 X:98075638-98075660 GTGAAGAATGGGAAAGTAAAGGG + Intergenic
1195496501 X:105541407-105541429 TTGAAGAAAAGGAGAGTAAGTGG + Intronic
1195866822 X:109441401-109441423 CTGAAGAAAAGGAGAGTCTTGGG + Exonic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196910875 X:120483069-120483091 ATGAAAAAATGGACAGGAAAAGG - Intergenic
1197222012 X:123923377-123923399 ATGAAGAAATGGAGACAGAAAGG - Intergenic
1197357879 X:125459008-125459030 ATGAAGAAATGGAGAGTAAATGG - Intergenic
1197374254 X:125663271-125663293 GGGAAGAAATTGAGAGTAAATGG + Intergenic
1197609201 X:128619978-128620000 CTGAAGAAAAGGAGAGGTAAAGG - Intergenic
1197732461 X:129822758-129822780 CTAAAGAAATGGCTAGTAAGAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198520246 X:137445250-137445272 TTCTAGAAATGGAGAGTAAGGGG - Intergenic
1198542129 X:137651273-137651295 CTCAACAAATTGAGAGTGAAAGG + Intergenic
1199595932 X:149505678-149505700 TTGAAGAAATGAATAGGAAAGGG - Intronic
1201176770 Y:11314606-11314628 CTGGAGAAATGAAGAGGAAGGGG - Intergenic
1201862696 Y:18616691-18616713 CTGAAAAGAAGGAGACTAAAAGG + Intergenic
1201870627 Y:18703689-18703711 CTGAAAAGAAGGAGACTAAAAGG - Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic