ID: 910277522

View in Genome Browser
Species Human (GRCh38)
Location 1:85464969-85464991
Sequence CGGGCGCTACCCGAGTCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910277522_910277537 17 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277537 1:85465009-85465031 CCCGGCCGAAGGCGGCGGGGTGG 0: 1
1: 1
2: 0
3: 19
4: 286
910277522_910277540 27 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277540 1:85465019-85465041 GGCGGCGGGGTGGCCGAGCCCGG 0: 1
1: 0
2: 10
3: 50
4: 469
910277522_910277531 6 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG 0: 1
1: 0
2: 1
3: 37
4: 432
910277522_910277526 -6 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277526 1:85464986-85465008 CGCCCGCACCACGGCGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 74
910277522_910277534 13 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277534 1:85465005-85465027 GTGGCCCGGCCGAAGGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 167
910277522_910277533 12 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277533 1:85465004-85465026 GGTGGCCCGGCCGAAGGCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 207
910277522_910277529 -1 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277529 1:85464991-85465013 GCACCACGGCGTGGGTGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 126
910277522_910277535 14 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277535 1:85465006-85465028 TGGCCCGGCCGAAGGCGGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 114
910277522_910277524 -10 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277524 1:85464982-85465004 GTAGCGCCCGCACCACGGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 36
910277522_910277525 -9 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277525 1:85464983-85465005 TAGCGCCCGCACCACGGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 22
910277522_910277532 9 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277532 1:85465001-85465023 GTGGGTGGCCCGGCCGAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910277522 Original CRISPR CGGGCGCTACCCGAGTCGCT CGG (reversed) Exonic