ID: 910277531

View in Genome Browser
Species Human (GRCh38)
Location 1:85464998-85465020
Sequence GGCGTGGGTGGCCCGGCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910277522_910277531 6 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG 0: 1
1: 0
2: 1
3: 37
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910277531 Original CRISPR GGCGTGGGTGGCCCGGCCGA AGG Exonic
900287126 1:1907146-1907168 GGCCTGGATGGCCCTGCTGAAGG - Intergenic
900392293 1:2438930-2438952 GGCGTGGGCTGCCCTGCCCAGGG + Intronic
900549541 1:3247404-3247426 GGCGAGGGCGGCCGGGCCGAGGG + Intronic
901100383 1:6715161-6715183 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
901836347 1:11926294-11926316 GGCGCGGGCGGCCGGGCCGGTGG - Exonic
903148161 1:21388121-21388143 GGGGTGGCTGGCCAGGCTGAGGG - Intergenic
903526235 1:23994155-23994177 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
903748525 1:25604188-25604210 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
903859148 1:26354627-26354649 GGCATGGCTGGCCAGGTCGAAGG + Intergenic
903894859 1:26596517-26596539 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
903894954 1:26596739-26596761 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
903923661 1:26818208-26818230 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
904077437 1:27853157-27853179 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
904106429 1:28088752-28088774 GGCGTGGCTCGCCGGGCCGGCGG - Intergenic
904165746 1:28553586-28553608 GGAGTGGGAAGCCCGGCCGCCGG + Intronic
904605860 1:31697200-31697222 GGGGTGAGTGGCCCGGCCCTTGG - Exonic
904696923 1:32336095-32336117 GGCGGGGTCGGCCCGGCCGGCGG + Exonic
904795081 1:33052125-33052147 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
905315960 1:37081464-37081486 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
906035955 1:42750612-42750634 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
906486915 1:46241286-46241308 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
907414544 1:54305095-54305117 GGCGTGGGAGGCCAGGCCAGGGG + Intronic
907453693 1:54562343-54562365 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
908062998 1:60372094-60372116 AGCCTGGGTGGCCAGGCAGAAGG + Intergenic
908370463 1:63473883-63473905 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
908467946 1:64415281-64415303 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG + Exonic
910777488 1:90891700-90891722 GGGGTGGCTGGCCAGGCAGAGGG + Intergenic
912298388 1:108489680-108489702 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
912471639 1:109910933-109910955 GGAGTGGGCGCCCCGGCCGAGGG - Exonic
912807979 1:112773491-112773513 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
912825244 1:112898555-112898577 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
913274234 1:117121930-117121952 GCCGTGGGCGGGGCGGCCGAAGG + Intronic
914231453 1:145766969-145766991 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
914231503 1:145767096-145767118 GGGGCGGCTGGCCCGGCAGAGGG + Intronic
914775154 1:150728881-150728903 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
915367839 1:155325371-155325393 GGCGTGGAGGGCCGGGCAGAGGG - Exonic
915410871 1:155700656-155700678 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
915936101 1:160091187-160091209 GGGGTGGGTGGCATGGCCCATGG + Intergenic
916223429 1:162466155-162466177 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
917375973 1:174349987-174350009 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
918228649 1:182509567-182509589 GGGGTGGCTGGCCAGGCTGAGGG + Intronic
919080063 1:192857323-192857345 GGGGTGGCTGGCCGGGCGGAGGG - Intergenic
920528352 1:206684955-206684977 GGCGGCGGGGGCCCGGCCGGGGG - Intronic
921414184 1:214869611-214869633 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
922102758 1:222488482-222488504 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1062860093 10:804288-804310 CGGGTGGGTGGCCCTGCCGCAGG - Intergenic
1063662281 10:8043145-8043167 GGCCGGGGTGGCCCGGGGGACGG + Intergenic
1065335921 10:24656302-24656324 GGGGTGGCTGGCCAGGCTGAGGG - Intronic
1068969760 10:62948136-62948158 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1069052552 10:63811303-63811325 GGGGGGGCTGGCCCGGCAGAGGG + Intergenic
1069052662 10:63811557-63811579 GGGGTGGCTGGCCAGGCAGAGGG + Intergenic
1069741331 10:70687763-70687785 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1069808066 10:71138304-71138326 AGCGGAGGTGGCCCGGCAGAGGG - Intergenic
1070162432 10:73874275-73874297 GGCGGGGGTGGGGCGGCCGAGGG + Intronic
1070318030 10:75333485-75333507 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1071616683 10:87081285-87081307 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
1072149921 10:92675215-92675237 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1072648312 10:97275841-97275863 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1072648415 10:97276067-97276089 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1072949516 10:99838582-99838604 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1073325949 10:102644079-102644101 GGCGAGGGCGGCCGCGCCGAGGG - Intergenic
1073386192 10:103129212-103129234 GGGGTGGCTGGCCAGGCTGAGGG - Intronic
1073386289 10:103129437-103129459 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1074152066 10:110767240-110767262 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1074588152 10:114787668-114787690 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1076395860 10:130136817-130136839 GGCCTGGGCGGCCCCGCCGCGGG + Intronic
1076668413 10:132105590-132105612 GGCGTGGGTAGCCCACCCCAGGG - Intronic
1076781906 10:132729078-132729100 GGCGTGGGGGGCCTGGACGCTGG + Intronic
1076868837 10:133182858-133182880 GGCGTGGGTGGCATGGGCGCAGG + Intronic
1077081516 11:726522-726544 GGGGTGGGAGGTGCGGCCGAAGG + Intronic
1077205234 11:1338836-1338858 GGGGTGGGGGGCCCGGGCCACGG + Intergenic
1080098065 11:28430462-28430484 GGGGTGGCTGGCCAGGCTGAGGG - Intergenic
1080098134 11:28430609-28430631 GGGGTGGCTGGCCGGGCGGAGGG - Intergenic
1081469733 11:43358926-43358948 GGTGTGAGCGGCCCGGCCGGGGG + Exonic
1081488089 11:43547286-43547308 GGCGTGGGTGTCAAGGCCCAGGG + Intergenic
1081872998 11:46391689-46391711 GGGGCGGGCGGCCGGGCCGAGGG + Intergenic
1082844731 11:57716739-57716761 GGGGTGGCTGGCCAGGCAGAGGG + Intronic
1083154665 11:60815469-60815491 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1083382407 11:62279018-62279040 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1083646052 11:64172278-64172300 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1083646106 11:64172405-64172427 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1084049016 11:66588032-66588054 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1084796199 11:71506033-71506055 GGCTTTGGAGGCCAGGCCGAAGG + Intronic
1086366232 11:86111113-86111135 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1087057105 11:93946793-93946815 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1087057280 11:93947195-93947217 GGGGTGGCTGGCCAGGCTGAGGG + Intergenic
1087948635 11:104194659-104194681 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1089585582 11:119507918-119507940 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1090791049 11:130091619-130091641 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1091303596 11:134523438-134523460 GGGGAGGCTGGCCCGGCCGCGGG + Intergenic
1091307264 11:134544270-134544292 TGCGTTGGTCGCCTGGCCGAGGG - Intergenic
1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG + Intronic
1091878866 12:3960347-3960369 GGGGTGGGTGCCACGGCTGATGG - Intergenic
1092401883 12:8184436-8184458 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
1092591081 12:9953271-9953293 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1095571187 12:43685448-43685470 CGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1096022235 12:48332993-48333015 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1096039355 12:48500507-48500529 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1096167377 12:49436584-49436606 GGGGTGGCTGGCCGGGCCGGGGG + Intronic
1096968734 12:55648672-55648694 AGACTGGGTGGCCCGGCAGAGGG + Intergenic
1097871984 12:64610050-64610072 GGTGGGGGTTGCCCGGCCGAGGG - Intergenic
1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG + Intronic
1099255242 12:80307464-80307486 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1099255362 12:80307767-80307789 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1101731011 12:107426752-107426774 GGCTTGGGTGGCCGGGCAGATGG - Intronic
1102151017 12:110689174-110689196 GGCGGGGGCGGCCCGGGCGGGGG - Intronic
1102174810 12:110867426-110867448 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1102174961 12:110867778-110867800 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1103299721 12:119918511-119918533 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1103299795 12:119918684-119918706 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1103381235 12:120495901-120495923 GGCGTCGGTTGCCCGGGCAATGG - Intronic
1103457120 12:121076336-121076358 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1103457277 12:121076691-121076713 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1104712598 12:130996733-130996755 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1104712652 12:130996860-130996882 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1104949551 12:132433047-132433069 GCCGTGGGGAGCCCTGCCGACGG + Intergenic
1105367813 13:19779468-19779490 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1105976758 13:25480195-25480217 GGAGTGGCTGGCCGGGCAGAGGG + Intronic
1106061802 13:26300327-26300349 AGCGTGGGTGGGCTGGACGAAGG + Intronic
1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG + Exonic
1107493190 13:40900757-40900779 GGGGTGGCTGGCCCGGCGGGGGG - Intergenic
1107493220 13:40900835-40900857 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
1107499124 13:40955862-40955884 GGGGTGGCTGGCCGGGCGGAGGG - Intronic
1108330363 13:49378499-49378521 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1108351437 13:49593238-49593260 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1110269440 13:73575090-73575112 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1111418191 13:87976315-87976337 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1113413448 13:110109998-110110020 GGCGTGCATGGCCCGGCTGCAGG - Intergenic
1113813154 13:113154187-113154209 GGCGTGGGGGGGCGGGCCGTGGG + Intergenic
1113813171 13:113154218-113154240 GGCGTGGGGGGGCGGGCCGTGGG + Intergenic
1114174837 14:20310261-20310283 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
1114428297 14:22639323-22639345 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1114626963 14:24136339-24136361 GGCGTGGCTGGAGCGGCCGGGGG + Intronic
1115847594 14:37555542-37555564 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1116191604 14:41673698-41673720 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1116191759 14:41674101-41674123 GGGGTGGCTGGCCTGGCAGAGGG + Intronic
1116480479 14:45389506-45389528 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1118854623 14:69611554-69611576 GGCGGGGGAGGCCCCGCGGAGGG - Intergenic
1119263635 14:73252147-73252169 GGCGTGGATGGCCCAGGGGAGGG + Intronic
1121306680 14:92911594-92911616 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1121994666 14:98592990-98593012 GGCGTGGGAGGCCAGGACCAAGG - Intergenic
1122568476 14:102677235-102677257 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1122963660 14:105111664-105111686 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1122963810 14:105112016-105112038 GGGGTGGCTGGCCAGGCTGAGGG + Intergenic
1124245884 15:28070402-28070424 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1124334975 15:28849593-28849615 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1125079283 15:35656327-35656349 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG + Exonic
1125659269 15:41382743-41382765 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1126295511 15:47132883-47132905 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1128938690 15:71769381-71769403 GGGGTGGTTGGCCGGGCAGAGGG - Intronic
1129428520 15:75481572-75481594 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1129431318 15:75503683-75503705 GGGGTGGCTGGCCAGGCAGAGGG - Intronic
1129431458 15:75503991-75504013 GGGGCGGCTGGCCCGGCAGAGGG - Intronic
1129431611 15:75504344-75504366 GGGGTGGCTGGCCCGGCAGAGGG - Intronic
1130340718 15:82998069-82998091 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1130428235 15:83822026-83822048 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1130946463 15:88553057-88553079 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1130946607 15:88553377-88553399 GGGGTGGCTGGCCAGGCTGAGGG + Intergenic
1131125346 15:89854256-89854278 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1131127270 15:89868077-89868099 GGGGTGGCTGGCCAGGCTGAGGG - Intronic
1131448557 15:92519798-92519820 GGGGTGGGTGGGCCGGCCACTGG - Intergenic
1132011515 15:98280612-98280634 GTCCTGGGAGGCCGGGCCGAAGG + Intergenic
1132399717 15:101497851-101497873 GGTGGGGGTGGCTCGGCCCAGGG - Intronic
1132831242 16:1929529-1929551 GGCGGGGGTGGCGCGGCCGGTGG - Intergenic
1133152992 16:3850781-3850803 GGCCTGGGTGGCCAGGCTCAAGG - Exonic
1134187856 16:12098599-12098621 GGGGAGGGTGTCCCGGCAGACGG - Intronic
1134854238 16:17505846-17505868 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1136202392 16:28698282-28698304 GGGGTGGCTGGCCAGGCTGAGGG + Intronic
1136270213 16:29144089-29144111 GGCCTGGCTGGCCTGGCCCAGGG + Intergenic
1136412634 16:30086097-30086119 GGGGTGGGTGGGCAGGCCCAAGG + Exonic
1136668656 16:31836768-31836790 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1137350857 16:47712846-47712868 GGAGTGGGTGGCCGGGCCCCGGG - Intergenic
1138507711 16:57486430-57486452 GGCGAGGGAGGCGCGGCCGCAGG + Exonic
1142049933 16:87951607-87951629 GGCGCGGGCGGCCCGGCGGGCGG - Intronic
1142153399 16:88522487-88522509 TGCTGGGGTGGCCCGGCCCATGG - Intronic
1142289329 16:89185554-89185576 GGCGTGAGGGGCCCGGCACAGGG + Intronic
1142825423 17:2507289-2507311 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
1142939725 17:3371595-3371617 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1143188258 17:5023564-5023586 GGCGAGGGGGGCCGGGCTGACGG - Exonic
1144482040 17:15637308-15637330 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1145205921 17:20984805-20984827 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1145684294 17:26638459-26638481 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1145684426 17:26638835-26638857 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1145954049 17:28842512-28842534 GGCACGGGTGGCCCGGTCGCCGG - Intronic
1145985934 17:29046217-29046239 CTGGTGGGTGGCCCGGCAGAGGG + Intronic
1146215997 17:30979560-30979582 GGGGCGGCTGGCCCGGCAGAGGG + Intronic
1146339538 17:32007481-32007503 GGCGGGAGGGGCCCGGCCGGCGG - Intergenic
1147189645 17:38731006-38731028 AGTGTGGGTGGCCCTGCCGTAGG + Intronic
1147598834 17:41733752-41733774 GGGGTGGGTGGGCGGGCGGAGGG - Intronic
1147963435 17:44180790-44180812 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1148090264 17:45019101-45019123 GGCGCGGGCGGCCCGGGCGGGGG + Intergenic
1148439325 17:47703449-47703471 AGCGCGGGTGCCCTGGCCGAAGG - Intronic
1148632919 17:49125838-49125860 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1149908986 17:60551660-60551682 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1150747168 17:67825600-67825622 GGCGGGAGGGGCCCGGCCGACGG - Intronic
1151624995 17:75271028-75271050 GGCGCGGGGGGAACGGCCGAGGG - Exonic
1153489183 18:5630228-5630250 GGCGAGGCTGGCCCGACCGGGGG - Intronic
1155910330 18:31498139-31498161 GGAGAGGGTGGCCGGGCCGGGGG + Exonic
1157136775 18:45063779-45063801 GGCGTGGGTGTCCCTGCAGCGGG - Exonic
1157566160 18:48680525-48680547 GGCCTGAGTGGCCCTGTCGACGG + Intronic
1157629363 18:49080412-49080434 GGGGTGGCTGGCCCGGCAGAGGG + Intronic
1157677297 18:49577871-49577893 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1158505538 18:58044024-58044046 GGCGGGGGTCACCCGGCCGCGGG - Intergenic
1160662487 19:307506-307528 AGCGTGGATGGCACGGCCGGTGG - Exonic
1160855142 19:1213868-1213890 GCCGTGGGAGGCCGGGGCGAGGG + Intronic
1160858905 19:1229414-1229436 AGCGTGGACGGCCCGCCCGACGG - Exonic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1161010507 19:1957454-1957476 GGCTTGGGTGGCCGGGCCTGTGG + Intronic
1162886952 19:13703587-13703609 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1163463835 19:17455090-17455112 GGTGGGGGTGCCCCGGCGGAGGG - Intronic
1164081759 19:21865903-21865925 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1164105966 19:22107572-22107594 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1164652404 19:29899401-29899423 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1164652712 19:29900082-29900104 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1164652897 19:29900486-29900508 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1166028514 19:40108614-40108636 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1166029909 19:40118326-40118348 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1166191762 19:41180649-41180671 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
1166191879 19:41180920-41180942 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
1166417889 19:42610195-42610217 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1166861903 19:45815990-45816012 GGCGGGCCTGGCCGGGCCGACGG + Exonic
1167433567 19:49466241-49466263 GGCGTGGGGGGCCCGGGTGCAGG + Exonic
1167557032 19:50203257-50203279 GGCGTGGGGGGGCCGACCGAAGG - Intronic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
1168281606 19:55308821-55308843 GGCGTGGGTGGCGGGGGCGGTGG + Intronic
1168288786 19:55347184-55347206 GGCGTGGGGGGGCTGGCCCAGGG - Exonic
1168572667 19:57483457-57483479 GGGGCGGCTGGCCCGGCAGAGGG - Intergenic
929516200 2:42606095-42606117 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
929614633 2:43297686-43297708 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
930202081 2:48556646-48556668 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
930202182 2:48556872-48556894 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
931719392 2:65056363-65056385 GGCGTGGTCAGCGCGGCCGAAGG + Exonic
932699695 2:73984631-73984653 GGCGAGGGTGGCCAACCCGAAGG + Intergenic
932699902 2:73985210-73985232 GGCGCGGGGGGCCCGGCCCGGGG + Intergenic
933735099 2:85488166-85488188 GGGGCGGCTGGCCCGGCAGAGGG - Intergenic
933735191 2:85488390-85488412 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
934277602 2:91587244-91587266 GGAGTGGATGGCCAGGCGGAAGG - Intergenic
934703564 2:96461890-96461912 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
935630531 2:105210447-105210469 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
936546234 2:113394587-113394609 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
937168575 2:119844002-119844024 GGGGCGGCTGGCCCGGCAGAGGG + Intronic
938006031 2:127788549-127788571 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
938092305 2:128441664-128441686 GGCCTGGGTGGCCCTGCCTATGG - Intergenic
938406372 2:131035286-131035308 GGGGTGAGTGGCGCGGGCGACGG + Intronic
938533947 2:132221507-132221529 GGGGTGGCTGGCCAGGCAGAGGG - Intronic
938829006 2:135033725-135033747 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
939578460 2:143922062-143922084 GGGGTGGCTGGCCAGGCAGAGGG + Intergenic
939584805 2:143991872-143991894 GGGGTGGCTGGCCAGGCAGAGGG - Intronic
941768903 2:169327399-169327421 GGGGTGGCTGGCCCGGCAGAGGG - Intronic
941768998 2:169327621-169327643 GGGGTGGCTGGCCCGGCAGAGGG - Intronic
941769229 2:169328151-169328173 GGGGCGGCTGGCCCGGCAGAGGG - Intronic
942020872 2:171866487-171866509 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
942630282 2:177945965-177945987 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
943411915 2:187557171-187557193 GGGGTGGCTGGCCCGGCGGGGGG - Intronic
945115024 2:206401117-206401139 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
947402553 2:229743427-229743449 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
947901307 2:233724187-233724209 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
948121619 2:235535164-235535186 GGTGCGGGTGGCCCGGTGGAGGG - Intronic
1169108686 20:3018880-3018902 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1170424912 20:16227598-16227620 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1170623016 20:18010421-18010443 GGGGTGGCTGGCCCGGCAGAGGG + Intronic
1171861431 20:30405496-30405518 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1171951693 20:31427258-31427280 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
1171951864 20:31427632-31427654 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1171956999 20:31470456-31470478 GGGGTGGCTGGCCTGGCAGAGGG + Intronic
1171957119 20:31470731-31470753 GGGGTGGCTGGCCAGGCAGAGGG + Intronic
1171957192 20:31470907-31470929 GGGGTGGCTGGCCCGGCAGAGGG + Intronic
1172059146 20:32176379-32176401 GGGGTGGCTGGCCAGGCTGAGGG - Intergenic
1172100881 20:32483525-32483547 GGCGGGGGTGGCCAGGAGGAGGG + Intronic
1172349527 20:34229866-34229888 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1172349850 20:34230620-34230642 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1172465559 20:35153694-35153716 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1172907332 20:38379144-38379166 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1174200166 20:48801612-48801634 GACGTGGGTGTCCTGGCCCAGGG - Intronic
1174343867 20:49915392-49915414 GCCGAGGACGGCCCGGCCGAGGG + Intronic
1174390548 20:50216140-50216162 GGAGGGGGTGGCCCGGTCCAGGG + Intergenic
1175870748 20:62208367-62208389 GGCGTGGGTTGCCCAGCACACGG - Intergenic
1176053146 20:63131135-63131157 TGTGTGGGTGGCCCGGCCCAGGG - Intergenic
1176157098 20:63627297-63627319 CGCGCGGGCGGCCGGGCCGAGGG + Intergenic
1176299034 21:5089999-5090021 GGTGTGGGTGGCCCGTCCCCTGG - Intergenic
1176348271 21:5770608-5770630 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1176355085 21:5891192-5891214 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1176496556 21:7553847-7553869 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1176542592 21:8168678-8168700 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1176561543 21:8351723-8351745 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1177178439 21:17720438-17720460 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1177188065 21:17819437-17819459 GGGGAGGGTGGCGCGGCCGCGGG + Intergenic
1179810170 21:43865152-43865174 GGCGGCGGCGGCGCGGCCGAGGG + Intergenic
1179857991 21:44171949-44171971 GGTGTGGGTGGCCCGTCCCCTGG + Intergenic
1180082239 21:45492236-45492258 GGCGGAGGTGGCTCGGCCTACGG - Intronic
1181043542 22:20204100-20204122 GGGGTGGGTGGCTCTGCCGAGGG + Intergenic
1181562265 22:23712467-23712489 GCCGTGGTTGGCACGTCCGAAGG - Intergenic
1181982116 22:26773232-26773254 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1182377317 22:29858003-29858025 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1182560216 22:31153652-31153674 GGGGTGGGTGGCCTGTCTGAGGG + Intergenic
1182982369 22:34684297-34684319 GGGGTGGCTGGCCAGGCCGGGGG + Intergenic
1183441418 22:37825154-37825176 GGCGTAGGTGGCCGGGCTGAAGG - Exonic
1183841204 22:40501480-40501502 GGGGCGGCTGGCCCGGCGGAGGG + Intronic
1183841448 22:40502057-40502079 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1183845342 22:40537201-40537223 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1183845541 22:40537680-40537702 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1184735982 22:46398097-46398119 GGAGTGGATGTCCCTGCCGAGGG + Intronic
1185255194 22:49827741-49827763 GGCTCGGGGGGCCCGGCCGGCGG + Intergenic
950754838 3:15163140-15163162 GGGGTGGCTGGCCCGGCAGAGGG + Intergenic
952308918 3:32169937-32169959 GGGGTGGCTGGCCGGGCCGGGGG - Intergenic
952896445 3:38081693-38081715 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
953972299 3:47356632-47356654 GGGGTGGGTGGCCCGGACCGGGG - Intergenic
954059440 3:48056351-48056373 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
954080781 3:48211675-48211697 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
954162858 3:48734600-48734622 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
955297477 3:57747769-57747791 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
955362822 3:58289891-58289913 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
955394821 3:58550080-58550102 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
956270488 3:67444247-67444269 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
957203315 3:77164722-77164744 GGGGTGGCTGGCCGGGCGGAGGG - Intronic
957203367 3:77164849-77164871 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
958808803 3:98837945-98837967 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
959042744 3:101439636-101439658 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
959085663 3:101849183-101849205 GGCAGGGATGGCCCGGGCGAGGG + Intronic
960862127 3:122164794-122164816 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
961120164 3:124366909-124366931 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
961120241 3:124367087-124367109 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
961120521 3:124367716-124367738 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
961619996 3:128216574-128216596 GGCGTGAGTGGGCTGGTCGAGGG - Intronic
962112947 3:132471143-132471165 GGGGTGGCTGGCCCGGCTGAGGG + Intronic
963244580 3:143047347-143047369 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
963770075 3:149380096-149380118 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
966359707 3:179120304-179120326 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
966360027 3:179121029-179121051 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
967177630 3:186874352-186874374 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
968831321 4:2934218-2934240 GGCGTGGGAGGCGCGGCCGTGGG - Exonic
970409364 4:15791263-15791285 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
973281417 4:48363823-48363845 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
973593530 4:52465193-52465215 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
975622057 4:76306176-76306198 GGGATGGGTGGCCCGGAGGACGG - Intronic
980056468 4:128083699-128083721 AGGGTGGCTGGCCCGGCAGAGGG + Intronic
981970542 4:150659814-150659836 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
983652383 4:170046898-170046920 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
983904347 4:173168922-173168944 GGCTTGGGTCGTCCGGCCGCGGG - Exonic
984639301 4:182144625-182144647 GGGGAGGGGGGCCCCGCCGAGGG - Intronic
985883363 5:2657380-2657402 GGCGGGTGTGGCCCGGCTGCAGG + Intergenic
987253321 5:16122687-16122709 GGAGTGGGTGGCGAGGCTGAGGG - Intronic
988552103 5:32208337-32208359 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
989211522 5:38862319-38862341 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
990458923 5:56014753-56014775 GGCGTGGCTGGCCCGGCAGAGGG + Intergenic
990459035 5:56015010-56015032 GGGGTGGCTGGCCAGGCAGAGGG + Intergenic
991910010 5:71551802-71551824 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
992373962 5:76171848-76171870 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
992574634 5:78097198-78097220 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
992828146 5:80569721-80569743 GGCGAGGGCTGCCCGGCCGCGGG - Intronic
992914321 5:81432895-81432917 GGGGTGGCTGGCCGGGCAGAGGG - Intronic
992978075 5:82139802-82139824 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
998432078 5:142076241-142076263 GGGGCGGCTGGCCGGGCCGAGGG + Intergenic
999180950 5:149670175-149670197 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1000985422 5:167859469-167859491 GGGGTGGCTGGCCAGGCTGAGGG - Intronic
1001394111 5:171403984-171404006 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1002013752 5:176305278-176305300 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1002013843 5:176305493-176305515 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1002341340 5:178518503-178518525 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1003552274 6:7109281-7109303 GGCGCGGGGGGCCCGGCCCAAGG - Intronic
1004388176 6:15189225-15189247 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1004424179 6:15496609-15496631 GGGGCGGCTGGCCCCGCCGAAGG + Exonic
1004874429 6:19939704-19939726 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1004874531 6:19939931-19939953 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1005606963 6:27485437-27485459 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1006064646 6:31454631-31454653 GGGGTGGCTGGCCTGGCAGAGGG + Intergenic
1006064804 6:31455013-31455035 GGGGTGGCTGGCCAGGCAGAGGG + Intergenic
1006064900 6:31455238-31455260 GGGGTGGCTGGCCTGGCAGAGGG + Intergenic
1006128384 6:31854216-31854238 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1006492364 6:34397757-34397779 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1006492417 6:34397884-34397906 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1006677806 6:35776740-35776762 GGAGAGGGTGGCCCCGCCGCCGG + Intronic
1008112087 6:47505700-47505722 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1008553618 6:52655786-52655808 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1010030312 6:71266163-71266185 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1011405141 6:87009988-87010010 GGGGTGGCTGGCCGGGCGGAGGG + Intronic
1011405187 6:87010086-87010108 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1011405242 6:87010213-87010235 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1011405320 6:87010391-87010413 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1013369187 6:109455331-109455353 GCTGCGGGTGGCCCGGACGAGGG + Intronic
1014557020 6:122849205-122849227 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1015220907 6:130802599-130802621 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1015476773 6:133665069-133665091 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1019404588 7:876929-876951 GCCGCGGGTCGCCCGGCGGAGGG + Intronic
1019439240 7:1038393-1038415 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1019453149 7:1110031-1110053 GGCGTGGAGGGCCCGGGAGAAGG - Intronic
1019645238 7:2125351-2125373 TGCGTGGGTGGCTCGGCTCAGGG - Intronic
1020004561 7:4775496-4775518 GGCGTAGGTGCCGCGGCCGGGGG - Intronic
1020281508 7:6652503-6652525 GGCCTGGGGGTCCTGGCCGACGG + Exonic
1020616402 7:10465732-10465754 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1021872381 7:25018742-25018764 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1023875848 7:44285855-44285877 GGCGTGGGGGGCGCGGCGGGGGG + Intronic
1025102982 7:56150841-56150863 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1025103406 7:56151818-56151840 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1025795935 7:64738667-64738689 GGGGTGGCTGGCCAGGCAGAGGG + Intergenic
1025796039 7:64738921-64738943 GGGGTGGCTGGCCCGGCAGAGGG + Intergenic
1025821533 7:64968042-64968064 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1026783306 7:73284172-73284194 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1027371202 7:77509516-77509538 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1028610021 7:92700501-92700523 GGCCTGGGTGGCCAGGTAGATGG + Intronic
1029334411 7:99888014-99888036 GGGGTGGCTGGCCGGGCAGAGGG + Intronic
1029439023 7:100577277-100577299 GGCGTGGGGGGCCCCGAGGAAGG - Exonic
1029569112 7:101359004-101359026 GGGGTGGCTGGCCTGGCAGAGGG + Intergenic
1030602897 7:111610395-111610417 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1034638493 7:152585606-152585628 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1035231639 7:157469255-157469277 TGTGTGAGTGGCCAGGCCGAGGG - Intergenic
1035507850 8:149778-149800 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1036536698 8:9657678-9657700 GGGGTGGCTGGCCGGGCTGAGGG + Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1037936355 8:22917454-22917476 GGCAGGGGTGGGCTGGCCGAAGG - Intronic
1039153286 8:34529114-34529136 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1039591989 8:38757196-38757218 GGGGTGGGGCGCCCGGCCGTAGG - Intronic
1040093213 8:43419327-43419349 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1040121200 8:43687529-43687551 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1041677218 8:60548668-60548690 GGAGTGGCTGGCCGGGCAGAGGG + Intronic
1041796539 8:61752979-61753001 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1042049072 8:64686013-64686035 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1044660720 8:94591034-94591056 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1044661003 8:94591691-94591713 GGGGCGGCTGGCCCGGCAGAGGG - Intergenic
1045298558 8:100892381-100892403 GGGGTGGCTGGCCGGGCCGGGGG + Intergenic
1047848028 8:128826359-128826381 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1048858060 8:138700661-138700683 GGTGGGGGTGGCCAGGCTGAAGG - Intronic
1048995069 8:139789185-139789207 GGCGTGGGTCTCCCGCCCGCCGG - Intronic
1049509039 8:143018600-143018622 GGCGGGGGCGTCCCGGCCGGGGG - Intronic
1049788524 8:144462611-144462633 GGCGGGGGCGGCCCGGCCGCGGG - Intronic
1052492698 9:29188937-29188959 GGGGTGGCTGGCCCGGCGGGGGG + Intergenic
1055137456 9:72841359-72841381 GGGGTGGCTGGCCAGGCTGAGGG + Intergenic
1055242166 9:74197837-74197859 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1055586635 9:77762387-77762409 GGGGTGGCTGGCCAGGCAGAGGG - Intronic
1055948384 9:81710601-81710623 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1056152560 9:83804211-83804233 GGGGTGGCTGGCCCGGCAGAGGG - Intronic
1056152800 9:83804730-83804752 GGGGTGGCTGGCCCGGCGGGGGG - Intronic
1058659834 9:107257405-107257427 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1059120927 9:111641089-111641111 GGGGTGGCTGGCCAGGCTGAGGG - Intronic
1059211121 9:112514538-112514560 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1059633919 9:116154294-116154316 GGCGCAGGTGGCCGGGCCGGCGG - Exonic
1060065040 9:120495891-120495913 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1060682534 9:125577770-125577792 GGGGCGGCTGGCCCGGCAGAGGG - Intronic
1060687170 9:125623895-125623917 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1060703664 9:125780266-125780288 GGGGTGGCTGGCCCGGCAGAGGG + Intronic
1060849304 9:126861005-126861027 GGCGCCGCTGGCCCGGCTGAGGG + Intronic
1061050408 9:128191633-128191655 GGCTCGGGTGGCGCGGCCGGAGG - Intronic
1061084952 9:128393204-128393226 GGCGGCGGTGGCCCGGGCGGCGG + Intergenic
1061982907 9:134116065-134116087 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1061983231 9:134116819-134116841 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1061983532 9:134117524-134117546 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1061983856 9:134118278-134118300 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1203794658 EBV:169974-169996 GGCTTGGCTGGCGCGGCCGGGGG - Intergenic
1203794859 EBV:170512-170534 GGCTTGGCTGGCGCGGCCGGGGG - Intergenic
1203795050 EBV:171035-171057 GGCTTGGCTGGCGCGGCCGGGGG - Intergenic
1203795251 EBV:171573-171595 GGCTTGGCTGGCGCGGCCGGGGG - Intergenic
1203463865 Un_GL000220v1:68156-68178 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1203405674 Un_KI270539v1:591-613 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1185641840 X:1592653-1592675 GGGGTGGGCGGCCGGGCCGGAGG + Intronic
1187225829 X:17375104-17375126 GGCGGGGGAGGCCGGGGCGAGGG - Intergenic
1187364034 X:18651946-18651968 GGCATGGGGGGCCAGGCGGAGGG - Intronic
1188477206 X:30602588-30602610 GGGGTGGCTGGCCGGGCTGAGGG - Intergenic
1189210274 X:39277852-39277874 GGGGTGGCTGGCCAGGCAGAGGG - Intergenic
1189955925 X:46275805-46275827 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic
1190337243 X:49269956-49269978 GGCGGCGGTGGCCCCGCGGAGGG + Exonic
1192463909 X:71341332-71341354 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1192621329 X:72681633-72681655 GGGGTGGCTGGCCGGGCTGAGGG - Intronic
1192768610 X:74166742-74166764 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1192768687 X:74166917-74166939 GGGGTGGCTGGCCCGGCAGAGGG - Intergenic
1192969744 X:76218039-76218061 GGGGTGGCTGGCCGGGCAGAGGG + Intergenic
1192969799 X:76218167-76218189 GGGGTGGCTGGCCGGGCTGAGGG + Intergenic
1193132229 X:77931669-77931691 GGGGTGGCTGGCCAGGCAGAGGG + Intronic
1194991995 X:100555823-100555845 GGGGTGGCTGGCCGGGCAGAGGG - Intergenic