ID: 910277531

View in Genome Browser
Species Human (GRCh38)
Location 1:85464998-85465020
Sequence GGCGTGGGTGGCCCGGCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910277522_910277531 6 Left 910277522 1:85464969-85464991 CCGAGCGACTCGGGTAGCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG 0: 1
1: 0
2: 1
3: 37
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910277531 Original CRISPR GGCGTGGGTGGCCCGGCCGA AGG Exonic