ID: 910277570

View in Genome Browser
Species Human (GRCh38)
Location 1:85465129-85465151
Sequence CGGCTGCCAAGAGGAGCCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910277570_910277573 -4 Left 910277570 1:85465129-85465151 CCGTCGGCTCCTCTTGGCAGCCG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 910277573 1:85465148-85465170 GCCGCTGAATGTGGTGCAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 86
910277570_910277575 14 Left 910277570 1:85465129-85465151 CCGTCGGCTCCTCTTGGCAGCCG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 910277575 1:85465166-85465188 GAAGGAGCCCAGCTCGCGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910277570 Original CRISPR CGGCTGCCAAGAGGAGCCGA CGG (reversed) Exonic
900142489 1:1144552-1144574 CCTCTGCCAACAGGAGCCCAGGG + Intergenic
900981320 1:6047792-6047814 CTGGTGCCATGAGGAGCCCATGG - Intronic
901447216 1:9315976-9315998 CGTCTGCCAAGAGGCCCCGCTGG - Intronic
905387826 1:37616385-37616407 TGGCTGGCAAGAGGAGCAGAGGG - Intronic
906570275 1:46832040-46832062 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
910277570 1:85465129-85465151 CGGCTGCCAAGAGGAGCCGACGG - Exonic
913082147 1:115398641-115398663 AGGCTTCCAAGAGGAGGTGATGG + Intergenic
915384968 1:155482271-155482293 CGGCTACCAAGAAGAGTAGATGG + Exonic
918451687 1:184664801-184664823 GGGCTGCCCAGAGGAGGGGATGG + Intergenic
920193114 1:204207473-204207495 TTGCTGCCAAGAAGAGCCCATGG + Intronic
920295403 1:204953191-204953213 CAGCTCCCAGGAGGAGCAGAGGG + Intronic
924541940 1:244989356-244989378 TCACAGCCAAGAGGAGCCGAAGG - Intronic
1068596793 10:58910727-58910749 ATGCTGCCAAGAAGAGCCTATGG - Intergenic
1071573718 10:86711487-86711509 CGGCTGCCAAGCGGAGTCCGGGG + Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1073068778 10:100780413-100780435 CAACTGCCAAGAGGAGCAGCAGG - Intronic
1073421224 10:103425210-103425232 CGGCTGCCAAGAGGACCATGAGG + Exonic
1075315230 10:121447857-121447879 CGGTTGCCAAGAGGGGCCATAGG + Intergenic
1075811338 10:125227088-125227110 CGGCGCCCAAGAAAAGCCGAAGG - Intergenic
1076084677 10:127616071-127616093 CCGCAGCCAAGAGGAGCCTGAGG + Intergenic
1076869704 10:133187323-133187345 CGGCTGGACAGAGGGGCCGACGG - Intronic
1085253940 11:75161735-75161757 GGGCTGCCAGGAGGAGCAGGTGG + Intronic
1090052218 11:123389486-123389508 TGTCAGCCAAGAGGAGCCTAAGG + Intergenic
1097990108 12:65825060-65825082 CGGCTGCCAAAAAGAGAAGAGGG - Exonic
1102708778 12:114906828-114906850 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
1104049139 12:125184837-125184859 CGGCTGCCAAGAGGGGATGGGGG - Intergenic
1106455910 13:29926615-29926637 CACCGGCCAACAGGAGCCGAAGG + Intergenic
1107359354 13:39602738-39602760 CGGCTGGCAGGCAGAGCCGACGG + Intronic
1114519109 14:23321748-23321770 CGGCAGCCAAGAGGAGGAGGAGG + Exonic
1114996906 14:28365311-28365333 TGGATGTCAAGAGGAGCAGAAGG + Intergenic
1116116268 14:40654908-40654930 TGACTGCCAAGAGGAGCCTAAGG + Intergenic
1118940497 14:70332106-70332128 CAGCTGCCAAGAGGTCCAGAAGG + Intronic
1120746056 14:88152992-88153014 AGGCTGCCAAGAGGAGGCCTGGG + Intergenic
1121418292 14:93794457-93794479 CCGCTGGCAAGAGGAGCACAAGG - Intergenic
1122117539 14:99535374-99535396 GGGCTGCCGAGAGGAGGCTATGG - Intronic
1122755767 14:103978559-103978581 CCACAGCCAAGAGGAGCCTAAGG - Intronic
1125387494 15:39153919-39153941 CAGGTGCCAAGAGGAGCAAAGGG - Intergenic
1126655495 15:50972762-50972784 TGTCTGCCAAGAGTAGCCTATGG + Intronic
1128947653 15:71840433-71840455 CTGATGCCAAGTGGAGCCCATGG + Intronic
1129351004 15:74956062-74956084 CAGCGTCCAAGAGGAGCCTAGGG - Exonic
1131155972 15:90075792-90075814 GAGCTACCAAGAGCAGCCGACGG - Intronic
1132186723 15:99807061-99807083 CGGCGGCCAAGAGGGGCCAGCGG - Intergenic
1132321105 15:100926348-100926370 GGGCTGCGAAGAGGAGCAGCAGG - Intronic
1132428964 15:101745650-101745672 CGGCGGCCAAGAGGGGCCAGCGG + Intronic
1132601739 16:775881-775903 AGGCTGTCAGGTGGAGCCGAGGG - Intronic
1132995551 16:2820655-2820677 CCTCAGCCAAAAGGAGCCGAGGG - Intronic
1134373813 16:13651286-13651308 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
1141746952 16:85932204-85932226 CCCCTGCCAAGAGGAGACGCTGG + Intergenic
1141748408 16:85941820-85941842 TGTCAGCCAAGAGGAGCCCACGG - Intergenic
1147743953 17:42683822-42683844 CGGCTGCGACGAGGAGCTGGTGG + Exonic
1149409372 17:56389377-56389399 CGGTTGCCAAGAGGAGAAGAGGG + Intronic
1151368310 17:73631221-73631243 GGGCTGCCAAGGAGGGCCGAGGG - Intronic
1151601376 17:75108342-75108364 AGGCTCCCAAGAGAAGCCAAAGG + Intergenic
1152464672 17:80459030-80459052 CAGCTGCCAAGAGGTGCCCCAGG - Intergenic
1152573490 17:81130500-81130522 AGGCTGCGAGGAGGGGCCGAGGG - Intronic
1152782399 17:82232072-82232094 TGGCTGCCGAGGGGTGCCGAGGG - Intronic
1154358612 18:13641645-13641667 CGGCGGCCCAGAGGAGCAGCAGG + Intronic
1158685206 18:59607599-59607621 AGGCTGCCGAGAGTAGCTGAAGG - Intronic
1158836654 18:61336922-61336944 CTGATGCCGAGAGGAGCCAAAGG + Intronic
1159956036 18:74519174-74519196 CAGCTGCCAAGAGAAGCAGGTGG + Intronic
1160532998 18:79576521-79576543 CGGCTGACAAGAGGAAGAGAAGG + Intergenic
1160571232 18:79818871-79818893 CGGCAGCCATGAAGAGCCGAAGG + Intergenic
1160734750 19:657437-657459 CGGGGGCCAAGAGGAGGCCAGGG - Intronic
1163453947 19:17395051-17395073 CGGCTGTGAAGAGGACCGGAGGG + Intergenic
1164770520 19:30804933-30804955 CAGCTGCAAGGAGGAGCGGAGGG - Intergenic
1166364385 19:42271054-42271076 AGGCTGCCCAGAGGGGCAGAGGG + Intronic
1166678424 19:44753620-44753642 CGGGTGTGAAGAGGAGCCGGTGG - Intronic
1167193450 19:48008657-48008679 GGGCAGCCAAGATGACCCGATGG + Exonic
1167924201 19:52810095-52810117 CGGCAGCCAAGAGGAGGGGGAGG + Intronic
1168297682 19:55385364-55385386 GGGCTGCCAGGATTAGCCGAGGG + Intronic
925076797 2:1023282-1023304 CTGCTGCCAAGAGAAGGAGATGG - Intronic
928904635 2:36356258-36356280 CGGCTGCGAGGAGGAGGCGGCGG + Exonic
932635030 2:73380565-73380587 CTGCTGCCAAAAGGAGCTGAGGG - Intergenic
933895944 2:86809531-86809553 CGGCTGGGCAGAGGTGCCGAGGG + Intergenic
936382647 2:112000410-112000432 CCACAGCCAAGAGGAGCCTAAGG - Intronic
937233808 2:120418393-120418415 GGGCTTCCAAGAGGAGGGGATGG + Intergenic
937559083 2:123198642-123198664 TTACAGCCAAGAGGAGCCGAAGG - Intergenic
937790501 2:125955909-125955931 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
939045349 2:137243453-137243475 TGGCTGCCAAGAGAAGCCCAGGG - Intronic
945182663 2:207107633-207107655 CGGCTGCACACAGGAGCCGGTGG - Intronic
945558320 2:211306487-211306509 GGACAGCCAAGAGGAGCCTATGG + Intergenic
947501966 2:230677402-230677424 CTGCTGCCAAGAGGAGGCTGGGG + Intergenic
948052438 2:234988690-234988712 CGGGTGCCAGGAGGAGCTCACGG + Intronic
948571847 2:238922608-238922630 CTGCTGCAAAGAGGCCCCGAGGG - Intergenic
948993397 2:241565584-241565606 CGCCTGCTAAGAGGAGGAGAGGG - Intronic
1173250266 20:41360736-41360758 TGGCTGCGAAGAGAAGCCGAGGG + Exonic
1174393843 20:50234028-50234050 CGGCTGCCAAGGAGAGCTGGAGG + Intergenic
1175178542 20:57128581-57128603 CGGCTGCCCAGAGCAGGGGAAGG + Intergenic
1175361802 20:58417713-58417735 AGTGTGCCAAGAGGAGCAGATGG - Intronic
1175718616 20:61272118-61272140 GGGCTGCCAAGAGGAGGAGGAGG - Intronic
1176201012 20:63860590-63860612 CGCCTGCCAGGAGGAGCCCCAGG - Intergenic
1178878395 21:36429880-36429902 AGGCTGCCTGGAGGGGCCGAGGG - Intergenic
1179604730 21:42507304-42507326 CAGCTGCCTAGAGGAACCCAGGG + Intronic
1180253367 21:46605164-46605186 TGGCAGCCAATGGGAGCCGAAGG + Exonic
1180924491 22:19544377-19544399 GGGCTGCCAAGAGCAGCCCCGGG - Intergenic
1181739841 22:24912121-24912143 CGACAGCCAAGAGGAGCTTAAGG + Intronic
1184114927 22:42416883-42416905 CAGCTGCCTAGAGGGGCCCACGG + Intronic
1184215086 22:43061363-43061385 CAGCTGCCAACAGGAGCCAGGGG - Intronic
1184736049 22:46398327-46398349 CGGATGCCAAGGGGAACCGCAGG + Intronic
949833741 3:8245433-8245455 TGACAGCCAAGAGGAGCCTAAGG - Intergenic
950282645 3:11720330-11720352 CGGGTGCCGAGAGGGGGCGACGG - Intronic
950392850 3:12710300-12710322 CAGCTGCCAGGGTGAGCCGAAGG + Intergenic
950413240 3:12852831-12852853 GGCCAGCCAAGAGGAGCCAAAGG + Intronic
953928659 3:46995265-46995287 CCGCTGCCAAGAGCAGCTGCTGG + Exonic
954108407 3:48421224-48421246 GTGCTGCCGAGAGGAGCCGGTGG - Exonic
954176859 3:48851632-48851654 CAGCTGCCAAGAGCAACTGATGG + Intergenic
954748124 3:52798519-52798541 TGGGTGCCAAGAGGAGGGGAGGG - Intronic
960250978 3:115453100-115453122 TTGCAGCCAAGAGGAGCCTAAGG - Intergenic
963041443 3:141072815-141072837 TGGCTGCCAGCAGGAGCGGATGG - Intronic
969301371 4:6299278-6299300 CCACAGCCAAGAGGAGCAGAGGG - Intronic
972793810 4:42397611-42397633 CGGGTCCCGAGAGGAGCCGGAGG - Intergenic
973701235 4:53539220-53539242 CCCCTGCCAAGTGGAGCTGAGGG + Intronic
973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG + Intergenic
976720827 4:88167267-88167289 AGGCAGCCAAGAGGAGCTGAGGG - Intronic
992082477 5:73248105-73248127 TCACAGCCAAGAGGAGCCGAAGG - Intergenic
992364877 5:76081871-76081893 CTCCTGCCCAGAGGAGCCGGTGG - Intergenic
992597481 5:78360816-78360838 GGGCTGCTAAGGGGAGCCGAGGG - Intronic
997656104 5:135555678-135555700 CGACAGCCAAGAGGAGCCTGAGG - Intergenic
997984386 5:138491609-138491631 CGGCTGGCAAGGGGAGACGCTGG + Intergenic
1010200975 6:73281830-73281852 CCACAGCCAAGAGGAGCCTAAGG - Intronic
1012476389 6:99618843-99618865 CGGCGGCCAGGCGGAGCCGGAGG + Intergenic
1016923189 6:149317005-149317027 CGGCGGCCGAGAGGAGCAGGTGG - Intronic
1020254701 7:6496601-6496623 TGGCTTCCAAGAGGGGCCTAGGG + Intergenic
1021874319 7:25034293-25034315 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
1023689711 7:42773170-42773192 CGTCTGCGAAGAGGAGAGGAGGG - Intergenic
1030984241 7:116222350-116222372 AGGCTGCCCAGAGGAGCAGGAGG - Intronic
1032623144 7:133558822-133558844 CTGCTTCCAAGAGAAGCCTAAGG + Intronic
1037802852 8:22044546-22044568 CGTCGGCCAAGAGGGGCGGAGGG + Intronic
1041166028 8:55093398-55093420 TCACTGCCAAGAGGAGCCAAAGG - Intergenic
1042114094 8:65412796-65412818 CAGCTGCCATGAGGGTCCGATGG + Intergenic
1044569484 8:93700842-93700864 CGGCGGCGAAGAGGAGCCCGGGG + Intronic
1045187954 8:99857511-99857533 AGGCTGCAAAGAGTAGGCGAGGG - Intronic
1049451801 8:142666023-142666045 CGGCTGCCGGGAAGAGCAGAGGG - Exonic
1049752470 8:144291705-144291727 CGGCCGCAAAGAGGGGCCGAGGG - Exonic
1050409201 9:5343966-5343988 CCACAGCCAAGAGGAGCCTAAGG + Intergenic
1053802091 9:41771051-41771073 CAGCTGCCAACAGGAGCCAGTGG - Intergenic
1054143179 9:61544238-61544260 CAGCTGCCAACAGGAGCCAGTGG + Intergenic
1054647996 9:67605380-67605402 CAGCTGCCAACAGGAGCCAGTGG + Intergenic
1060656623 9:125376585-125376607 CTGCTGCAAAGAGGAGGCGTGGG - Intergenic
1062581047 9:137229420-137229442 TGGCTCCCAAGAGGATGCGAAGG + Exonic
1192149882 X:68705618-68705640 GGGCTGCCCAGAGGGGCCGGAGG + Intronic
1192211935 X:69133219-69133241 GGGGAGCCAAGAGCAGCCGACGG - Intergenic
1196388898 X:115189701-115189723 CGGCATTCAAGAGCAGCCGATGG + Exonic