ID: 910280472

View in Genome Browser
Species Human (GRCh38)
Location 1:85495037-85495059
Sequence CAGTTCCAGCAGAGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 396}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910280465_910280472 18 Left 910280465 1:85494996-85495018 CCCATACAATGTCCTGCTTTTGC No data
Right 910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG 0: 1
1: 1
2: 3
3: 39
4: 396
910280468_910280472 -4 Left 910280468 1:85495018-85495040 CCATCTTACTGCTCATTAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 178
Right 910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG 0: 1
1: 1
2: 3
3: 39
4: 396
910280464_910280472 26 Left 910280464 1:85494988-85495010 CCACATTTCCCATACAATGTCCT No data
Right 910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG 0: 1
1: 1
2: 3
3: 39
4: 396
910280463_910280472 27 Left 910280463 1:85494987-85495009 CCCACATTTCCCATACAATGTCC 0: 1
1: 0
2: 2
3: 10
4: 169
Right 910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG 0: 1
1: 1
2: 3
3: 39
4: 396
910280467_910280472 6 Left 910280467 1:85495008-85495030 CCTGCTTTTGCCATCTTACTGCT No data
Right 910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG 0: 1
1: 1
2: 3
3: 39
4: 396
910280466_910280472 17 Left 910280466 1:85494997-85495019 CCATACAATGTCCTGCTTTTGCC 0: 1
1: 0
2: 0
3: 7
4: 161
Right 910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG 0: 1
1: 1
2: 3
3: 39
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910280472 Original CRISPR CAGTTCCAGCAGAGGGCAGG CGG Intronic
900294578 1:1942557-1942579 CAGCTCAAGCACAGGGCACGTGG + Intronic
900572893 1:3368103-3368125 CATTCCCAACAGAGGGGAGGAGG + Intronic
900793227 1:4692871-4692893 CAGTTCCAGCACAGAGCACAGGG - Intronic
901633179 1:10657770-10657792 CTGCCCCATCAGAGGGCAGGCGG + Intronic
901759038 1:11458899-11458921 CAGGCCCAGGAGGGGGCAGGAGG - Intergenic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
901830144 1:11887250-11887272 CAGTTCCAGCATTCTGCAGGTGG + Intergenic
902784247 1:18722715-18722737 CAGTGCCAGCAGGGAGCAGGAGG + Intronic
903358290 1:22761664-22761686 GAGGTCCAGGAGAGGGAAGGAGG - Intronic
905319378 1:37105119-37105141 CAGTAGCAGCAGGTGGCAGGTGG - Intergenic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
905539381 1:38747845-38747867 CGGCTCAAGCAGAGGGGAGGTGG - Intergenic
906733803 1:48105299-48105321 CAAATCAAGCAGAGGGCAAGTGG - Intergenic
907268153 1:53275234-53275256 CTGCTCCTGCAGAGGGCAGGTGG + Intronic
907486126 1:54779469-54779491 CCATTGCAGCAGAGGCCAGGAGG - Intergenic
907525151 1:55049696-55049718 CATGGCCAGCAGAGGGCAGGTGG - Intronic
908067588 1:60424043-60424065 CACTTCTAGCTGAGGGCAAGAGG - Intergenic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
909510611 1:76448061-76448083 CAGTGCAAGCAGAGAGGAGGGGG + Intronic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
911121999 1:94305643-94305665 CAGTGCCAATAGATGGCAGGGGG + Intergenic
911247587 1:95535615-95535637 CGGGTCCAGCACAGGGCTGGTGG + Intergenic
911643637 1:100315820-100315842 CAGTGCCAGCAGAGCACAGGAGG + Intergenic
913286684 1:117233058-117233080 CCCTTCCCGCAGAGGGAAGGAGG - Intergenic
915286753 1:154858196-154858218 CAGGTCCAGCCCAGAGCAGGAGG + Intronic
915310137 1:155002467-155002489 CAGTCCCTGCAGAGCGCAGATGG - Intergenic
915572523 1:156752084-156752106 GAGATGGAGCAGAGGGCAGGCGG - Intronic
915657392 1:157372735-157372757 CAGTTCCAGGATGGGGCAAGAGG - Intergenic
915704584 1:157831907-157831929 GAGAACAAGCAGAGGGCAGGCGG + Exonic
916477347 1:165183106-165183128 CTGTTCCATCACAGGCCAGGAGG + Intergenic
917350735 1:174074952-174074974 CTGTTTCAGCAGAGGGCACTAGG - Intergenic
917371849 1:174301480-174301502 CTCTGCCAGCAGAGGGCAGAGGG + Intronic
917556134 1:176090556-176090578 CAGCAGCAGCACAGGGCAGGGGG + Intronic
917796820 1:178538696-178538718 ACGTTCCAGCATAGTGCAGGGGG + Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
920078329 1:203353359-203353381 CACTTCCAGGAGGGGCCAGGGGG + Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
923678474 1:236100259-236100281 CTGGGCCAGCAGAGGACAGGAGG - Intergenic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
1063502733 10:6569782-6569804 CAGTTGCAGAAAAGAGCAGGAGG + Intronic
1064179529 10:13102165-13102187 CATTTCGGGCAGAGGGCAGAAGG + Intronic
1065404754 10:25351338-25351360 CAGCTTCAGCAGAAGGCAGTGGG + Intronic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1066007134 10:31155762-31155784 CAGTGCCATCACATGGCAGGTGG - Intergenic
1066461800 10:35619077-35619099 CAGATCCGGCAGGGGGCCGGGGG - Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1068987479 10:63120673-63120695 CAGGGCCAGCAGATGGGAGGAGG + Intergenic
1069329635 10:67277245-67277267 CAGTTGCATCAGAAGGCAGTGGG - Intronic
1070609810 10:77925931-77925953 CAGGTCCAGTAGCGGGTAGGGGG - Intronic
1070685299 10:78476052-78476074 TAGTCCCGGCAGAGGGCAGAGGG - Intergenic
1070877245 10:79825979-79826001 ATGTCCCAGCGGAGGGCAGGGGG - Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071326055 10:84519405-84519427 AAGTTCCAGCCTTGGGCAGGAGG - Intergenic
1071570145 10:86692271-86692293 CAACTCCAGCAGTGGGCAGCAGG + Intronic
1071643742 10:87342023-87342045 ATGTCCCAGCGGAGGGCAGGGGG - Intergenic
1071790801 10:88952086-88952108 CATTTGCAGCAGAGCGCAGCAGG - Intronic
1073257245 10:102160774-102160796 CAGCTCCAGCAGTGAGGAGGAGG + Exonic
1074048186 10:109858332-109858354 CAGTGCCAACAGTGGCCAGGTGG - Intergenic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075215217 10:120526816-120526838 CAGGTACTGCAGAAGGCAGGGGG - Intronic
1075348144 10:121699394-121699416 CAGATCTGGCAGAGGGCAGAGGG + Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075842073 10:125513473-125513495 CATGTCAAGAAGAGGGCAGGTGG + Intergenic
1075936122 10:126342943-126342965 CAGGACCAGCAGAGAGGAGGAGG - Intronic
1075957177 10:126534086-126534108 CAGTTCCAAGGGAGGACAGGAGG - Intronic
1076453705 10:130574967-130574989 CAGTTCCACCACACAGCAGGAGG - Intergenic
1077228182 11:1447372-1447394 GAGTTGCAGCAGAGGCCAAGAGG - Intronic
1078152198 11:8768727-8768749 CTAGTCCAGAAGAGGGCAGGAGG - Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080189421 11:29526453-29526475 CAGTTCCAGTAGAGGCCAGAGGG - Intergenic
1081908793 11:46686900-46686922 CAGTCCCTGCTGAGGGCAGTGGG - Intronic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1084607563 11:70181311-70181333 CAGTCCCCACAGAGGGCAGGGGG + Intronic
1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG + Intergenic
1087391224 11:97537554-97537576 TGATGCCAGCAGAGGGCAGGAGG - Intergenic
1088286840 11:108198958-108198980 CAGTGCCAGCGGAGGGCTGAAGG - Intronic
1089061043 11:115626327-115626349 CAGTTCCAGCAGAAGGCCCTGGG + Intergenic
1089457748 11:118635129-118635151 CAGGTACTGCAGAGGCCAGGTGG - Intronic
1089928383 11:122283143-122283165 CAGTTCCATCAGCTGGAAGGTGG - Intergenic
1090356867 11:126146420-126146442 GAGTTCCAGCAGGAAGCAGGGGG + Intergenic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1091338482 11:134792306-134792328 CAGCTTCTGCAGAGGGCAGGAGG - Intergenic
1091822611 12:3487506-3487528 GAGTCCCAGCACAAGGCAGGTGG + Intronic
1092492244 12:8956200-8956222 TGGTGCCAGGAGAGGGCAGGAGG - Intronic
1093727605 12:22532974-22532996 CAGTTCCAGCTGAGGGGTGAAGG + Intronic
1096657336 12:53099618-53099640 CTGTTCCACCAGAGGCCAGAAGG - Intronic
1096680615 12:53252876-53252898 CAGTTCCAGCCCCAGGCAGGAGG - Exonic
1096796707 12:54082494-54082516 CTGTTCCCGCAAAGGGCGGGGGG - Intergenic
1097515097 12:60594594-60594616 CAGCACTAGCAGAAGGCAGGAGG + Intergenic
1098316338 12:69197457-69197479 CACTTGCAGCAGAAGGCAAGGGG + Intergenic
1099007127 12:77247418-77247440 AACTACCAGCAGAGGGAAGGAGG + Intergenic
1100524490 12:95406805-95406827 TCGTTCCAGCATAGAGCAGGAGG + Intergenic
1101561449 12:105861534-105861556 CACTTCCAGCAGAGTGTATGTGG - Intergenic
1103939304 12:124493171-124493193 CAGTTGGGGCAAAGGGCAGGAGG + Intronic
1103993637 12:124815283-124815305 CATGTCCTGCAGTGGGCAGGCGG - Intronic
1105002895 12:132702684-132702706 CAGTCCAGGCACAGGGCAGGTGG + Intronic
1105485899 13:20832111-20832133 CAGTTACAGAATAGGGCAGGTGG - Intronic
1105882903 13:24618990-24619012 CTGTTCCGCCAGAGAGCAGGAGG + Intergenic
1107022517 13:35766143-35766165 CAGATCCAGCAGAGGGATCGGGG + Intergenic
1107261605 13:38498484-38498506 CAGTCCCAGCGGAGCCCAGGTGG - Intergenic
1107409400 13:40144424-40144446 TGGTTCCAGCAGAGAGCAGCAGG - Intergenic
1108214898 13:48174552-48174574 CTGTTCCAGCAGAGGGAAGTGGG - Intergenic
1108704517 13:52973195-52973217 CAGTTCCAGCCAAGGTCAAGAGG + Intergenic
1110019665 13:70454876-70454898 CAGTTACAGCAGAAGGGAAGAGG + Intergenic
1110758865 13:79208011-79208033 AAGTGCCAGCTGAGGGTAGGAGG + Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1111560651 13:89940633-89940655 CAGTTCCTATAGAGAGCAGGAGG + Intergenic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1113492451 13:110703134-110703156 CATTTCCAGAAGAGGTCAGAGGG - Intronic
1113859841 13:113474311-113474333 CAGTTCCTGCACAGGGCACAAGG - Intronic
1113902218 13:113803706-113803728 CAGACCCTGCAGAGAGCAGGGGG - Intronic
1115952619 14:38737896-38737918 GGCTTCCAGCAGAGGGCTGGGGG + Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1118011747 14:61616790-61616812 CAGTTTCATCTGTGGGCAGGAGG - Intronic
1118738699 14:68722327-68722349 CCGTTCAAGCAGAGGACAGCAGG - Intronic
1118866930 14:69711486-69711508 CTGTTCCTGCAAAGGGCAGTAGG - Exonic
1119644730 14:76340012-76340034 CAGTTCCATCTCGGGGCAGGCGG + Intronic
1121030663 14:90656003-90656025 CGGTTCCAGGAGTGGGCAGGCGG - Intronic
1121368685 14:93337542-93337564 CAGCACCTGCAGAGGGCAGGAGG - Intronic
1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG + Intergenic
1122465013 14:101926780-101926802 AAGTGACAGCAGTGGGCAGGAGG - Exonic
1122921509 14:104882327-104882349 CGCATCCAACAGAGGGCAGGAGG - Intronic
1123921956 15:25076492-25076514 CAGCCCCAGCTTAGGGCAGGAGG - Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1125502059 15:40245978-40246000 CAGGTCTAGCAGAATGCAGGGGG - Intronic
1126200305 15:45978299-45978321 CAGTTCCAGCATAGGAAGGGTGG - Intergenic
1126792733 15:52235759-52235781 AATTTCTAGCAGAGGGAAGGGGG + Exonic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128134021 15:65249534-65249556 CACCTCCAGCAGAGGCCTGGAGG - Intronic
1128154646 15:65384998-65385020 CAGTTCCAGCAGGGGGCAGCAGG + Exonic
1129741529 15:77991959-77991981 CAGGCCCGGCAGAGGGCACGAGG - Intronic
1129844130 15:78760445-78760467 CAGGCCCGGCAGAGGGCACGAGG + Intronic
1130257676 15:82333355-82333377 CAGGCCCGGCAGAGGGCACGAGG - Intergenic
1130597263 15:85256608-85256630 CAGGCCCGGCAGAGGGCACGAGG + Intergenic
1131424216 15:92332258-92332280 AAGTTCCAGCAGGAAGCAGGTGG - Intergenic
1131537131 15:93246740-93246762 AGGTTCCAGGAGAGTGCAGGAGG + Intergenic
1132185708 15:99800313-99800335 CAGTCCCAGCAGGGGCCAGCGGG - Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132683697 16:1153703-1153725 CAGCACCTGCAGAGGACAGGGGG - Exonic
1133039411 16:3052453-3052475 CAGCTTCAGCGGGGGGCAGGGGG + Intronic
1133043254 16:3072086-3072108 CAGCTTCAGCAGGGGGCAGGGGG + Intronic
1133392492 16:5421472-5421494 CAGTTCCAGTAGAGAGAATGGGG + Intergenic
1133661077 16:7918459-7918481 CACTCCCAGAAGAGGCCAGGAGG - Intergenic
1134291176 16:12903453-12903475 TAGTTCCAGCAGATGGGAGAAGG + Intronic
1135675209 16:24409230-24409252 GACATCCAGCAGAGAGCAGGAGG + Intergenic
1138207529 16:55135663-55135685 CAGTTCCTGCAGACCTCAGGTGG - Intergenic
1138426014 16:56932429-56932451 CATCCCCAGCAGAGGGCGGGGGG - Intronic
1139496917 16:67326713-67326735 CGGCTCCAGCAGCGGGCGGGCGG + Exonic
1139564700 16:67766800-67766822 CAGATCCAGTACAGGGCAGGTGG - Intronic
1139847224 16:69929578-69929600 CAGCTCCAGCACTGGGCAGGTGG + Intronic
1140217450 16:73019819-73019841 CAGTTCCAGTTGTGGGCAGATGG - Intronic
1140967147 16:79977879-79977901 CAGGCACAGCAGAGAGCAGGTGG - Intergenic
1141481710 16:84310966-84310988 CAGTTTAGGCAGAGGCCAGGAGG + Intronic
1142158177 16:88542469-88542491 CCTTCCCAGCAGATGGCAGGAGG - Intergenic
1143001485 17:3797942-3797964 GAGTTCCTGCTGAGGGCAGTGGG - Intronic
1143176384 17:4957600-4957622 CAGCTCCAGGAGAGGGGAGCAGG + Intergenic
1143278350 17:5731292-5731314 TACTTCCAGCAGGGGGAAGGAGG - Intergenic
1143493091 17:7294916-7294938 CCCTTCCCGCAGAGGCCAGGTGG - Intergenic
1143916259 17:10295451-10295473 CTGTTCCTGCGAAGGGCAGGAGG + Intergenic
1144564505 17:16348853-16348875 CAGGTACAGCAGAGCCCAGGGGG + Intronic
1144881050 17:18430956-18430978 CAGCTCCAGCAACGTGCAGGTGG - Intergenic
1145151182 17:20513430-20513452 CAGCTCCAGCAACGTGCAGGTGG + Intergenic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146632581 17:34481496-34481518 CACTGCAAGAAGAGGGCAGGCGG - Intergenic
1146676712 17:34778784-34778806 AAGGTCCAGCAGTGGGGAGGTGG + Intergenic
1146682145 17:34816100-34816122 CATTTTAAGCAGAGGGCTGGGGG - Intergenic
1146683798 17:34826922-34826944 CAGACCCAGAAGAGGTCAGGGGG - Intergenic
1147422817 17:40331079-40331101 CAGCTCCAGGACAGGGCGGGTGG + Exonic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1148134688 17:45284655-45284677 CAGTTCCAGCCGACCTCAGGTGG + Intronic
1148734735 17:49858979-49859001 CAGTGCCAGCTGAAGGCCGGGGG + Intergenic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150627259 17:66849436-66849458 CAGATCCAGCAGTGGGGTGGTGG + Intronic
1151431230 17:74064728-74064750 CATTTACAGGAAAGGGCAGGTGG - Intergenic
1151716059 17:75831524-75831546 CAGGACCAGCAAGGGGCAGGTGG + Intronic
1152688357 17:81706024-81706046 CAGCACCACCCGAGGGCAGGGGG - Intronic
1152785081 17:82243491-82243513 GAGTCCCACCAGAAGGCAGGTGG - Exonic
1153807391 18:8721330-8721352 CAGGTGCAGCAGATGGGAGGGGG - Intronic
1153817013 18:8799275-8799297 CAGATCCAGATGAGGACAGGCGG + Intronic
1153962587 18:10152247-10152269 CAGAGCCAGCAGTGGGCAGGTGG - Intergenic
1157539469 18:48489592-48489614 AAATTCCAGGAGAGGGCAGGAGG + Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1157912398 18:51629502-51629524 CAGTTCCATAAAAGGACAGGGGG - Intergenic
1158328709 18:56338075-56338097 GTGTTCCAGGAGAGAGCAGGAGG - Intergenic
1160236955 18:77093291-77093313 GAGCTGCAGCAGAGGGAAGGCGG + Intronic
1160947457 19:1650408-1650430 GAGTTCCAGCAGAGCCCTGGGGG + Intronic
1161349692 19:3784944-3784966 CACTTCCAGCCCAGGTCAGGTGG + Intronic
1161360904 19:3849164-3849186 CAGCACCAGCAGAGGGCTGTGGG + Intronic
1161919819 19:7257736-7257758 AAGTACCAGCAAAGGGCAGCTGG + Intronic
1162463849 19:10829494-10829516 AGGCACCAGCAGAGGGCAGGCGG - Intronic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165351764 19:35279573-35279595 CAGTACCTCCAGAGAGCAGGAGG - Exonic
1165720801 19:38078281-38078303 GAGCACCAGAAGAGGGCAGGTGG - Intronic
1166123301 19:40698927-40698949 TGTTCCCAGCAGAGGGCAGGGGG - Intronic
1167326942 19:48832492-48832514 CAGTTTCAGCACAGGCCTGGGGG + Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926500880 2:13650765-13650787 CTCCTCCAGCAGAGGGCAGAGGG + Intergenic
926847858 2:17161733-17161755 GAGTTCCAACAGAAGGCAGATGG + Intergenic
927247923 2:20972906-20972928 CAGTTCCACCAGTTGGCAGCTGG + Intergenic
927719039 2:25371620-25371642 CACTTCCAGCAGGGGTCTGGGGG - Intergenic
928739579 2:34334563-34334585 TAATGCCAGCAAAGGGCAGGTGG - Intergenic
931172910 2:59823631-59823653 CATTTCCAGAAGAAGGCAAGGGG + Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
934761397 2:96858876-96858898 CAAGTCCAGCAAGGGGCAGGTGG + Intergenic
936440738 2:112550268-112550290 ATGTTCCAACAGAGGCCAGGTGG - Intronic
937065287 2:119012690-119012712 AGCTTCCAGCAGAGGGAAGGGGG - Intergenic
937261013 2:120586880-120586902 CAGCCCCAGCAGGGGGTAGGAGG + Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
937696107 2:124810426-124810448 CAGATACAGTGGAGGGCAGGGGG + Intronic
937911661 2:127078534-127078556 GAGTGGCAGCAGGGGGCAGGTGG + Intronic
938018251 2:127885591-127885613 ATGTCCCAGCGGAGGGCAGGGGG - Intronic
938702560 2:133892699-133892721 AAGTCTCAGCAGAAGGCAGGTGG + Intergenic
939146987 2:138427055-138427077 AATTTCAAGCAGAGGGCAAGTGG - Intergenic
939722365 2:145669724-145669746 GAGTTCCTACAGACGGCAGGTGG - Intergenic
945057256 2:205879846-205879868 CCCTTCCAGCAGAGAGCAAGAGG - Intergenic
945857142 2:215082408-215082430 TAGTACCAGCTGAGGGCTGGTGG - Intronic
946160599 2:217833504-217833526 CAGTTCTAGCACAGCCCAGGTGG + Intronic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
948518064 2:238518618-238518640 CAGTTCCTGGAGAGGAGAGGTGG + Intergenic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
948772778 2:240260035-240260057 GAGCCCCAGCAGAAGGCAGGTGG + Intergenic
1169193744 20:3672764-3672786 CCGTTCCCGCAGAGCGCCGGCGG + Exonic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1171969106 20:31552280-31552302 CAGCTTCAGCAAAGGGCTGGAGG + Intronic
1171971766 20:31569315-31569337 CAGCTCCAGGACAGGGCAGGGGG + Exonic
1172269211 20:33644054-33644076 CAGCACCAGCCTAGGGCAGGTGG - Intronic
1172428427 20:34871944-34871966 CAATTCCAGCAGAGGGCTGAGGG + Intronic
1172696875 20:36829010-36829032 CAGGGCCAGCCTAGGGCAGGTGG - Intronic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1174056268 20:47800483-47800505 GTGTTCCAGCAGAGAGAAGGAGG + Intergenic
1174597824 20:51698589-51698611 CAATTCCAGTGGAGGGGAGGAGG + Intronic
1175923935 20:62462885-62462907 CAGGTCCAGTGGGGGGCAGGTGG + Intergenic
1175959174 20:62626391-62626413 CAGTCCCAACCCAGGGCAGGAGG + Intergenic
1176129498 20:63490730-63490752 CAATGCCTGCAGAGGGGAGGGGG + Exonic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1177974011 21:27825208-27825230 CAGTTCCAGCAGTGGCAAGCAGG + Intergenic
1178928466 21:36795320-36795342 TAGGTCCCACAGAGGGCAGGAGG + Intronic
1178995285 21:37393764-37393786 CAGTGCCAGCAGATGCCACGTGG - Intronic
1179494812 21:41764855-41764877 CAGGCCCAGCAGAGCACAGGAGG + Intronic
1179622926 21:42630737-42630759 CAGTGCCAGCAGAGGTGCGGAGG + Intergenic
1179794136 21:43772701-43772723 AATTTCCAGCGGAAGGCAGGTGG - Exonic
1179797620 21:43794548-43794570 CAGTAGCAGCAGAGGACACGCGG - Intronic
1179961914 21:44772432-44772454 CAGACCCAGCAGAGGGCCAGGGG - Intronic
1180012395 21:45059400-45059422 CAGGTCCAGAAGAGGCCTGGGGG - Intergenic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1181112923 22:20612388-20612410 TCGTCCCTGCAGAGGGCAGGAGG - Intergenic
1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG + Intronic
1181610115 22:24006469-24006491 GAGTCCCCCCAGAGGGCAGGTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182458873 22:30470366-30470388 CAGGTCCAGAGGAGGGAAGGGGG - Intronic
1183859970 22:40662723-40662745 CAGTTGCAGCACTGGGTAGGTGG + Intergenic
1184423885 22:44397689-44397711 CACAGCCAGCACAGGGCAGGTGG - Intergenic
1184578768 22:45397983-45398005 CTCTGCCAGCAGAGGGCAGAGGG - Intronic
1184586730 22:45452924-45452946 CAGTTCTAGCTGAGGGATGGTGG - Intergenic
1184741658 22:46432072-46432094 CAGTGCCAACCCAGGGCAGGTGG - Intronic
1184926324 22:47642291-47642313 CAGTGCCAGCAGAGACCATGTGG + Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
1185269761 22:49923896-49923918 CAGTCCCAGCAGCAGGGAGGAGG + Intronic
949495006 3:4622951-4622973 AAGTTCTAGCAGTGGGGAGGAGG + Intronic
950196882 3:11015590-11015612 CAGCTCCTACAGAGGGCAGCAGG - Intronic
950476187 3:13216361-13216383 CATTACCAGCAGGGGACAGGGGG + Intergenic
950571303 3:13801655-13801677 CAGTGCCAGCGGTGGGCAGCGGG + Intergenic
950624684 3:14236209-14236231 CACTCCCAGCAGACGGCAAGAGG + Intergenic
951207552 3:19940339-19940361 AAGCTCTAGCAGAGTGCAGGAGG - Intronic
952779627 3:37082975-37082997 CAGTTCAAGCAGAGGTCAAATGG - Intronic
953511010 3:43539144-43539166 CAGTACCAGGAGGGAGCAGGAGG - Intronic
953768390 3:45761077-45761099 CAGCAGCAGCAAAGGGCAGGTGG - Intronic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
953911220 3:46893991-46894013 GAGGTCCTGCAGAGGCCAGGTGG + Exonic
954004955 3:47583345-47583367 CAGTTTCAGAACTGGGCAGGTGG - Intergenic
954042849 3:47902706-47902728 CAGTTGAATCAGAGGGCAAGTGG + Intronic
954287360 3:49628591-49628613 CCCATCCAGCAGAGAGCAGGAGG + Intronic
958128100 3:89383494-89383516 CAGTTCCAGCACAGGGCAGGTGG - Intronic
959468609 3:106721013-106721035 GGGTGCCAGCAGAGGGCAGAGGG + Intergenic
960164051 3:114381792-114381814 CTGTTTCTTCAGAGGGCAGGAGG + Intronic
961455209 3:127020599-127020621 AAGTACCTCCAGAGGGCAGGAGG + Intronic
961673762 3:128552560-128552582 CAATTACAGCAGAGGTCTGGTGG + Intergenic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
962292332 3:134147183-134147205 CAGTTCCCTCTTAGGGCAGGGGG + Intronic
962580017 3:136789826-136789848 CAGTTCCAGCAAAGGTCACGTGG - Intergenic
965165996 3:165195029-165195051 AAGATCCAGCAGTGGGGAGGAGG - Intronic
965557779 3:170035678-170035700 GAGTTAGAGCAGAGGGCATGGGG - Intergenic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
966883685 3:184363008-184363030 CAGTCCGCGCCGAGGGCAGGTGG - Intronic
967263485 3:187669272-187669294 CAGTTCCTGTATAGGGCAGAAGG + Exonic
967719744 3:192803147-192803169 TAAATCCAGCAGAGGGCAGAAGG - Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
968832114 4:2937870-2937892 CTGTTCCAGCAGAGGGACTGTGG + Intergenic
969112876 4:4854660-4854682 CAGTTCCGGCAGGGGGTGGGAGG - Intergenic
969367570 4:6707198-6707220 CAGTTCCAGCACTGGGGAGATGG - Intergenic
970603936 4:17661811-17661833 GAGTCCCAGGAGAGGGGAGGGGG + Intronic
970682193 4:18522799-18522821 CAGATAAAGCAGAGGGCAGTAGG - Intergenic
973808436 4:54547643-54547665 GAGTCCCAGCTGAGGGCAGGTGG - Intergenic
976119750 4:81766982-81767004 CAGTCCCTGCAGAGGTCAGGGGG - Intronic
979660193 4:123244255-123244277 CAGTCCCACCAGAGTGCAGCAGG - Intronic
980791976 4:137632161-137632183 CAGTGGCAGCACAGAGCAGGGGG - Intergenic
981391498 4:144196690-144196712 CCCTTCCATCAGAGGGCCGGGGG + Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
983972287 4:173890024-173890046 CAGTTCCAGCTGAGGGCTCAGGG - Intergenic
988893805 5:35650291-35650313 GAGTTTCTGCAGAGGGTAGGAGG - Intronic
989069415 5:37495037-37495059 CAGTTATAGCAGAGAGCATGTGG + Intronic
989537792 5:42583444-42583466 CACTTCCACTAGAGGGCAGCAGG - Intronic
995917246 5:117262687-117262709 GATTTCCAGCAGAGAGCAGCTGG - Intergenic
996046002 5:118873948-118873970 CAGTTGCAACAGAGTGCTGGTGG - Intronic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
997240229 5:132301398-132301420 CAGCTGCAGAAGAGGACAGGAGG - Intronic
998631081 5:143899322-143899344 GGGTTCCAGCAGAATGCAGGAGG + Intergenic
998952240 5:147404015-147404037 CAGCCTCAGCAGAGGGCATGAGG + Intronic
999102698 5:149039698-149039720 AAGTTGCAACATAGGGCAGGTGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999375507 5:151083819-151083841 AAGTTCCAGAAGAGGGGTGGAGG + Intronic
999682443 5:154072775-154072797 CAGTTCCTGCAGAAAGCCGGCGG + Intronic
999948142 5:156619644-156619666 CTTTTCCAGCAGAGGCCAAGGGG + Intronic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001136496 5:169107029-169107051 CATTTCCTGCACAGGGCAGGCGG - Intronic
1001403655 5:171461175-171461197 AATTTGCAGCAGAGGGCAGTGGG + Intergenic
1001698439 5:173689859-173689881 CGGCTGCAGCAGCGGGCAGGAGG - Intergenic
1001820056 5:174703435-174703457 AAGATCCAGCAGAGGTCTGGGGG + Intergenic
1002193579 5:177490985-177491007 AAGTGCCAGCCCAGGGCAGGGGG - Intronic
1005012253 6:21347305-21347327 CTGTTCCAGGCAAGGGCAGGGGG - Intergenic
1005493493 6:26368683-26368705 AAGTTCCAGCCTAAGGCAGGTGG + Exonic
1005498064 6:26406027-26406049 GAGTTCCAGCCTAAGGCAGGTGG + Exonic
1005502730 6:26444075-26444097 GAGTTCCAGCCTAAGGCAGGTGG + Exonic
1006361311 6:33588853-33588875 CTGTGCCAGCCGAGGGGAGGTGG + Intergenic
1006890852 6:37426879-37426901 CACTTCAACCAGAGGGCAAGAGG + Intergenic
1007224125 6:40301054-40301076 CACTTCCAGCAGAAAGAAGGTGG + Intergenic
1007509539 6:42364672-42364694 CAGCCCCTGCAGAAGGCAGGAGG + Intronic
1009645553 6:66396298-66396320 CAATGCCAGCGGACGGCAGGAGG - Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1009808807 6:68635428-68635450 CAGTACCTGCAGGGGGGAGGAGG + Exonic
1010340246 6:74741849-74741871 GAGTTCCAGCAGAAGGCCGGAGG - Intergenic
1010764665 6:79765324-79765346 CAGCACCAGCAGAGGGCAAGAGG - Intergenic
1011930121 6:92701088-92701110 CACTGCTGGCAGAGGGCAGGAGG + Intergenic
1013079779 6:106802039-106802061 CCTTCCCAGCAGAAGGCAGGAGG - Intergenic
1013323451 6:109019354-109019376 TGGTTCCAGCAGAGTGCTGGGGG + Intronic
1013339245 6:109197228-109197250 CAGTCCCAAGAGAGTGCAGGTGG - Intergenic
1015058055 6:128928549-128928571 CCGTTCAAGGAGAGGGAAGGAGG + Intronic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1016478274 6:144452689-144452711 TAATTCCAGCACAAGGCAGGAGG + Intronic
1017247919 6:152247232-152247254 CAATAACAGCAGAGGGCATGGGG - Intronic
1017772890 6:157656747-157656769 CAGTCACAGCAGAGAACAGGAGG - Intronic
1017888713 6:158621955-158621977 CCCTTCCAGCCCAGGGCAGGTGG - Intronic
1018225345 6:161622661-161622683 CAATCCCAGGAGAGGGCATGAGG - Intronic
1018581096 6:165308968-165308990 CAGTCCCAGCACATGGCGGGTGG + Intronic
1018757178 6:166860354-166860376 CAGCCCCAGGAGAGGGCAGATGG - Intronic
1019041128 6:169107163-169107185 CAGATCCAGGAGAGGGGAAGGGG + Intergenic
1019184042 6:170210550-170210572 CATTGCCAGCAGAGGGGAGACGG + Intergenic
1019699747 7:2468912-2468934 CATTTCCAGCTCGGGGCAGGCGG - Intergenic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020241116 7:6395970-6395992 TGGTTCCACCAGTGGGCAGGAGG + Intronic
1023183493 7:37510228-37510250 AATACCCAGCAGAGGGCAGGAGG - Intergenic
1023303720 7:38801134-38801156 AACTTCCAGCAGAGGGGAGGAGG + Intronic
1023834917 7:44062364-44062386 AGCTTCCTGCAGAGGGCAGGTGG - Intronic
1023911509 7:44560047-44560069 CTGTTCCAGCAGTGGGGAGATGG - Intergenic
1024323299 7:48089790-48089812 CAGGTCCCGCAGGGCGCAGGCGG + Intronic
1025823334 7:64991765-64991787 CAGATCCAGTAGAGGCCAGAGGG + Exonic
1026029374 7:66776571-66776593 TAGTTCCAGCTGAGGCCAGAAGG + Intronic
1027681924 7:81232737-81232759 CAGCACCAGCGGAGGGCAGGAGG + Intergenic
1028135599 7:87220258-87220280 CAGTTCCGGCAGAGAGCGCGGGG - Intronic
1028885355 7:95926821-95926843 GAGTCTCAGGAGAGGGCAGGTGG - Intronic
1029307460 7:99630625-99630647 AAGATCCAGCACGGGGCAGGAGG - Exonic
1030058976 7:105608010-105608032 CATATCCAGCAAAGGGCAGCTGG + Intronic
1031164812 7:118215103-118215125 CAGAGCCAGAAGAGGACAGGAGG - Intronic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1032075067 7:128832233-128832255 TATTTCCAGGACAGGGCAGGCGG - Intronic
1032488252 7:132304797-132304819 GGGTTGCAGCAGAGGACAGGGGG - Intronic
1032649091 7:133857979-133858001 CAACACCAGCGGAGGGCAGGAGG + Intronic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1033035954 7:137876590-137876612 CAGTTACAGGAGAGAGTAGGTGG - Exonic
1033108944 7:138558129-138558151 CAGATCCAGTAGAGGCCAGAGGG + Intronic
1033314069 7:140283348-140283370 CAGTCCCAGCAAAGGGCACCTGG + Intergenic
1034484401 7:151349590-151349612 CTGTTCCAGTAGAGGTCAGAGGG + Intronic
1034987868 7:155528525-155528547 CAAGTCCAGCAGAGGGTGGGTGG + Intronic
1035566594 8:645171-645193 CAGTGCCAGCCGAGGGAAAGGGG - Intronic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036387674 8:8296145-8296167 CACTCCCAGCAGAGAACAGGGGG - Intergenic
1037584127 8:20264864-20264886 CATTTCCAGCTGAGGGGAAGAGG + Intronic
1037689516 8:21170541-21170563 CACATCCTGCAGAGGGGAGGGGG - Intergenic
1038084560 8:24180354-24180376 CTGTTCCAGCAGAGGTCTAGGGG + Intergenic
1038396248 8:27247654-27247676 CAGTTCCAGGAGAGGTTTGGTGG - Intronic
1038611409 8:29062977-29062999 CAGTGCGAGCAGAGTGCTGGGGG + Intronic
1039326630 8:36492388-36492410 CAGTTCTAGCAAAGGGGATGTGG - Intergenic
1039591390 8:38752835-38752857 TCCTTCAAGCAGAGGGCAGGAGG - Intronic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1040529591 8:48255796-48255818 CCGTTCCAGTAGAGGCCAGTTGG + Intergenic
1044122253 8:88412330-88412352 GAGTTCCACCTGAGGTCAGGAGG + Intergenic
1045272107 8:100670826-100670848 CTCTGCCAGCAGAGGCCAGGAGG - Intergenic
1045665944 8:104484672-104484694 CAACTCCAGCAGAGGCCAAGAGG + Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1048071772 8:131028870-131028892 CAGGTACAGCTGGGGGCAGGAGG - Intronic
1048305671 8:133282759-133282781 CAGTTGCAACAGAGGTCATGTGG + Intronic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1049472820 8:142783889-142783911 CAGTTCCAGCTGAGGGGCTGGGG - Intergenic
1049985637 9:948237-948259 CACTTTCAACAGAGGGGAGGAGG - Intronic
1050775417 9:9253883-9253905 CACTTCCTGCAGAGGGCTTGGGG + Intronic
1050808965 9:9719497-9719519 TGGTACCAGCAGAGGGCAGGAGG - Intronic
1052437214 9:28444340-28444362 CAGTGCCAGCAGAGAACAGGAGG - Intronic
1053138000 9:35663807-35663829 CAGTTCCAGCTGAGGGCCTCAGG + Intronic
1053509142 9:38672526-38672548 CAGACCCAGCAGGGGGCAGCAGG - Intergenic
1054158746 9:61659052-61659074 CTGTTCCCGCAAAGGGCCGGGGG + Intergenic
1054449874 9:65398121-65398143 CTGTTCCCGCAAAGGGCGGGGGG - Intergenic
1054478520 9:65590057-65590079 CTGTTCCCGCAAAGGGCCGGGGG + Intergenic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1057016587 9:91657682-91657704 CAGTCCCAGCAGAGGGGATGGGG - Intronic
1057357348 9:94342704-94342726 CTGTGCCAGCACAGGGCATGGGG - Intergenic
1057650404 9:96914922-96914944 CTGTGCCAGCACAGGGCATGGGG + Intronic
1060053695 9:120394833-120394855 CACTTCCACCAGAGGTCACGAGG - Intronic
1060806864 9:126583220-126583242 CAGATCCAGCGGTGGGCAGAGGG + Intergenic
1061420012 9:130468059-130468081 CATCTCCAGGAGAGGGTAGGTGG - Intronic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1062004435 9:134232114-134232136 CAGCCCCAGGGGAGGGCAGGAGG - Intergenic
1062406596 9:136399779-136399801 CAGTTCACGCAGCGAGCAGGAGG - Intergenic
1062457378 9:136646065-136646087 CATATCCACCAGAGGGCAGCTGG + Intergenic
1062548517 9:137074926-137074948 CAGGTCCAGAAGAGTGCATGTGG + Intergenic
1062697171 9:137881329-137881351 CAGCTCCACCACAGGACAGGAGG + Intronic
1062732467 9:138117830-138117852 CACATGCAGCAGAGGTCAGGGGG - Intronic
1185540427 X:898974-898996 CAGTTCCCTCAAAGAGCAGGGGG - Intergenic
1185846805 X:3445400-3445422 CAGTGCCAGCAGCATGCAGGTGG + Intergenic
1186474311 X:9845433-9845455 CTGTTCCAGCAGGAAGCAGGGGG - Intronic
1186671597 X:11772516-11772538 CAGTTCCAGTAGAGATAAGGAGG + Intronic
1189516769 X:41720330-41720352 CACTTCCTGGAGAGGGCAGGGGG + Intronic
1190302683 X:49065642-49065664 CAGCTCCTGCGGAGGGGAGGAGG - Intronic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1192087009 X:68110095-68110117 CAGTTCCAGAAGAGGGGATTTGG - Intronic
1195370237 X:104166378-104166400 CCGGTCCAGCAGGGGGCACGGGG + Intergenic
1196753135 X:119135464-119135486 CTGTTCCAGCATTGGGGAGGAGG + Intronic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1199785640 X:151102563-151102585 CAGAGCAAGCAGAGGTCAGGTGG - Intergenic
1199980022 X:152915794-152915816 CAGTTCCTCCAGAGGCCAGCAGG - Intronic
1200300515 X:154969892-154969914 GAGTTCCAGAAGAGGTCAGCAGG - Intronic
1200817697 Y:7550517-7550539 CAGTGCCAGCAGCATGCAGGTGG - Intergenic