ID: 910282639

View in Genome Browser
Species Human (GRCh38)
Location 1:85518355-85518377
Sequence TTCTCTTAGACTGTACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910282639_910282647 27 Left 910282639 1:85518355-85518377 CCTTCCTGTACAGTCTAAGAGAA No data
Right 910282647 1:85518405-85518427 TGGCAGAATTCAGTTCCATGTGG 0: 7
1: 81
2: 189
3: 364
4: 703
910282639_910282644 7 Left 910282639 1:85518355-85518377 CCTTCCTGTACAGTCTAAGAGAA No data
Right 910282644 1:85518385-85518407 TTCCCTGCTCGTTCAGGTGTTGG 0: 2
1: 0
2: 0
3: 9
4: 102
910282639_910282641 1 Left 910282639 1:85518355-85518377 CCTTCCTGTACAGTCTAAGAGAA No data
Right 910282641 1:85518379-85518401 ATCCCTTTCCCTGCTCGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910282639 Original CRISPR TTCTCTTAGACTGTACAGGA AGG (reversed) Intronic
No off target data available for this crispr