ID: 910286120

View in Genome Browser
Species Human (GRCh38)
Location 1:85556141-85556163
Sequence GAGAAGGAGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11535
Summary {0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910286120_910286125 -9 Left 910286120 1:85556141-85556163 CCTTCCTCCTTCTCCTCCTTCTC 0: 7
1: 77
2: 663
3: 2492
4: 8296
Right 910286125 1:85556155-85556177 CTCCTTCTCCTCCTTCCCCTGGG 0: 1
1: 1
2: 16
3: 177
4: 1052
910286120_910286124 -10 Left 910286120 1:85556141-85556163 CCTTCCTCCTTCTCCTCCTTCTC 0: 7
1: 77
2: 663
3: 2492
4: 8296
Right 910286124 1:85556154-85556176 CCTCCTTCTCCTCCTTCCCCTGG 0: 1
1: 2
2: 36
3: 266
4: 1411
910286120_910286134 26 Left 910286120 1:85556141-85556163 CCTTCCTCCTTCTCCTCCTTCTC 0: 7
1: 77
2: 663
3: 2492
4: 8296
Right 910286134 1:85556190-85556212 AAAATGTTCCTCATTACTGCTGG 0: 1
1: 0
2: 2
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910286120 Original CRISPR GAGAAGGAGGAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr